WAR MODE - Tom O'Neill I

Episode Date: August 30, 2023

www.epsteinjustice.com www.michaelstrangefoundation.org www.patreon.com/WARMODE for part 2

Turn it up. Gotcha. That way. Can't put it off another day. I don't care what others say. They think we don't listen anyway. Time has come today. Hey! What year is that? Probably about 67 maybe, 68 I'm not sure. I've never been a lot of place to stay. What year is that? Probably about 67, maybe, 68, I'm not sure.

I've never, I mean, I know Ginger Baker got a lot of props for being a white drummer, but it's rare to have a white drummer in an all that is insane. I mean, I'm not just hearing that now made me remember I actually have the drummer's drumsticks. So wait, what happened? What was the whole? Well, we would sneak into concerts in the field house at Villanova. And this was the first one that I went to or ten. I wanted my brother Timmy and Bruce Mann the kid across the street and it was I Believe for some reason it was a matinee concert like in the afternoon And my recollection is getting up to the stage and it was 95 99%

African-American audience even though Villanoaversity wasn't yeah not at all. Yeah, and and by this song which was probably the encore I can't remember that well. One of the guys in the band just grabbed me, bar the arm and pulled me on the stage and at the end they have the gong and they gave it to me and I'm hitting it, banging it. Yeah that's so cool man. I wish I was video this. Yeah I don't think they did it the th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi the thi the thi thi thoen. the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the their their their their th. thi. thi. thi. thi. thi. thi. thi. the the. the. thee an the an the an the an the an the an the an the an the an the an the an the an the an the. I wish I was video of this. Yeah, I don't think they did it back then. That would have been fantastic. And then the drummer, who was the only white guy in the band, threw me as drumsticks. That's so cool.

And I'm trying to think now if they're... I have a lot of stuff scattered, so I'm going to talk to him tonight and see if their drumsticks in there. What was a scene like in Villanova like at that time? In the town of Villanova? Yeah, because like I drive, I used to like drive trash trucks and like I'm all around there. Yeah. And like I couldn't imagine like was it kind of more like wooded? Because there's a ton ton ton ton ton ton ton th th the th th th th th th th the th th th thon thin the thin thin thin thin thin thin thin thin like tho thoen thoan the the like the like the' theoloa' thin- like thianova like thioloa thioloa thioloin like thiolin like thiolin like, like in thi thi thin like in thin like in th like in th like in th like in th like in th like in th like in th like in th like in th like th like thin like thin like thin like thin like thin like thin like thin thin thin thin thin the the the the the the the the thi the the thi thi the thi thi thi thi thi thi thi thi th won that NCAA tournament. Not the first one they won, but the one they won, can remember was it the 90s or something? Or even later, when they got a lot more money and put up all those new buildings. I grew up behind what was, it was a pond.

It was called College Pond. This is like the early 60s. And we literally lived on the dividing line. It was the the the the the the the the theauauauauauauauauauauauc, th. th. th. th. th. th. th. thine, thine, thine, th. thine, thoes, th, thoes, thoes, th, thoes, thoes, was thoes, was th. I was th. I was tho. I was thoes, was thoes, was thoes, was th. I was th. I was th. I was th. I was th, was th, was th, was th, was th, was th. I was th. I was th. I was th. I was th. I was th. I was th. I was th. I was thin, was thin, was thin, was thin, the, the, thoo thooooooooooooooooooooo the. I was thoan, was thoan, was tho tho tho the lived on the dividing line. It was Rosemont and Villanova. And my house backed into College Pond when I was a kid. We'd skate there and catch salamanders and stuff. And then they filled in the pond and built the girls dorm. And that was the only really new building there for a long time, and a boy's dorm. Then the trolley tracks tracks tracks tracks tracks tracks tracks tracks tracks, tracks, tracks, tracks, tracks, tracks, tracks, tracts, th, th, th, th, th, the thacks, the th, the th, the the th, the thanks, the the the the the the the the the the the the the the the the the the the the the the the the the the th, the th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, thi, thi, thi, the, the, the-a, the, the, the, the andoomo, theaugh, the, thea, thea, theaugh, and the, and the a boys dorm. Yeah, then the trolley tracks

Then the athletic complex, which was the original field house and the football field So when we were little kids, you know, we were going up there from the time we were five or six just you know to get in trouble to make money I told you guys I shoo shi-shined when I was a kid. Yeah, that's that's that's th. Yeah, that's that's that's that's that's that's that's that's that's that's they, they, they, they, they, they. they. they. they. they. they. they. they. they. their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their th. triol-o. tre. true. true. true. true. true. tr-o-s. trolle. the the the the their their their when I was a kid up there. That's crazy. I scalped pure hustler. Yeah, we'd have to. It's like something from another time. We go to the football games and we dressed real sloppy, you know. And I mean, we were mainline kids, so it was kind of a fraud. But we were shitty clothes and asked people for extra tickets and they give us a ticket. And then as soon as they went in, we'd sell the ticket and we just do it. Yeah, we sold newspapers, we scopped tickets

and had a whole ritual at the game. We'd play football with the Garrett Hill kids, which was like the other side of the train tracks behind the stands, but within the complex after the game, we'd scavenge. So we'd go through the stands and look for money and food and liquor. And we didn't even know better. We would get a bottle of fifth of something that had an inch of whiskey in it.

Backwash. We would just pull up. We would pour them all. And we didn't know they don't do that. And then we would break into the press, they, they, they, the press, the press, the press, the press, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, we, we had, we had, we had, we had, we had, we'd, we'd, we'd, we'd, we'd, we'd, we'd, we'd, we'd, we'd, we'd. We'd. We'd. We'd. We'd. We'd. We'd. We'd. We'd, we'd, we'd, we'd, we'd. We'd. We'd. We'd, we'd. We'd. We'd. We'd. We'd. We, we'd th. We, we'd th. We. We. We. We, we'd th. We. We. We, we'd th. We. We, we'd th. We'd th. We'd th. We'd th. We'd th. We'd the. We'd to to to to to to to to to to to to to the. We didn't the. We didn't the. We didn't the. We'd the. We'd the would break into the press, they had a press room that, you know, where they broadcast the games from. We always had a way, I can't remember how, but we would get in there and they'd always leave really good food and stuff and we take all the, I mean, you would think we were poor. Yeah, yeah.

But, um, and went to concerts, I mean, I saw Bruce Springsteen open for Jackson Brown. Show, EJ's gonna freak out. Yeah, yeah. I was gonna say you were like the original Courtney Cox getting pulled up on stage by the Chambers. Not Bruce Springsteen. In fact, I didn't remember it was Bruce Springsteen until in college or something, somebody had a poster from the car. I remember seeing Jackson Brown and then this band of Greasers.

They all have black leather jackets. My memory was they were good but I didn't know it was Springsteen. That was the Eastry band? That was, you know, I found the date of the concert. I saw the poster 20 years ago and that's when I realized who it was and then I looked it up like 10 years ago but now I can't remember it was probably, well I read his biography, he mentions it, I think it was right after he started playing the main point, which I worked at actually for a couple years, but that was when I was in college. I dropped out of college for a couple years

and went back and lived at home. And before I went back to school, I worked at the main point. That's what my uncles used to say that he would would, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, thi, th... th. th. th. the the the the the the the the the the the the the the the the the the, the, the, the, the, the, the, the, the, the, the, the they. they. they. they. they. they. they. they. they. they. they. they. they. th. th. to, to, to, to, to. te. te. tea. tea. te. te. te. te. te. to. te. te. th. th. th. to back to school, I worked at the main point. That's what my uncles used to say that he would, like, they would be down in Seattle City in New Jersey for, like, just getting away in the summer. And he would be playing at like LaCoss and stuff. And people be like, I wrong, dude, this guy's here again. Yeah, this is brutal. Yeah.

Yeah. Yeah, I mean, my older brother, th. th. th. th. to. to. to. to. to. to. to. to. to. to. to. to. to. the the the to. the th. the the toe. the the toe. the toe. the toe. toe. the the toe. toe. toe. toe. toe. the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the they. the they. they. th. th. the. th. the. tooooooooooooooooooooooooo-s. tol. tol. th. toooooooe. th. th. the the main point all the time. But I never did that. And by the time I was working there, he was long gone from playing shows there. And you saw it like change from like shining like the whole scene change in front of your eyes? Yeah, yeah, all of a sudden they weren't wearing. The women never had their shoes shined. But the men did. And then all of a sudden, they they they they they they they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't they weren't the the the their. thoome. th. the thoome. tho. their. their. their. they were. they were. their. their. their. their. thoom. thoom. thoom. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. the. I. th men did, and then all of a sudden they just weren't wearing shoes anymore. And that was cool, I mean, because we actually got to see the AnyWar thing start there.

You know, not knowing that I was going to be writing about it one day, but it was late coming at Colovo, but it came and they, uh, I mean, the Hary Christian's, I mean, the Hary Christians were, I got in so much trouble. When I was in fifth grade... I got way into the Hare Christian. I went to Washington DC for a field trip when I was a little kid and I was like, these guys are like handing out books. Yeah. And I was like, oh, they have the answers, man, I had the answers, manned. When I was in fifth grade. been invited to speak to my class by me. My parents got called.

You're a bit of a rascal. Yeah, I was a troublemaker, but yeah, it was great. And when we were peeping Tom's and the girls dorm, we would just watch everything that happened there. That's crazy. And then at the end of the year, we were talking about them moving into the dorms, who would make money moving them in. At the end of the year, they would dump all their crap behind this parking lot, which was like this kind of, nobody knew about it, but it was a ravine between one of the parking lots and the trolley tracks, and they would always throw all their playboys and they could they couldn't take them them them them them them them them them their.., their., their. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh.... Oh. Oh....... Oh..... Oh..... Oh. Oh. Oh.. Oh. Oh.. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh. the. the. the. the. the. the. the. the. the. the. the. the. Oh. Oh. Oh. Oh. Oh. Oh. Oh. Oh feel like they've never been bought ever. Everyone has found them in some sort of press. Yeah, but we would go and they, you know, sometimes we'd go back again because we didn't want to bring them home and get caught. Yeah. And we tried to keep them to try.

And we would look at them and I since I remember they were like the pages a great place to grow up at Villanova. Then my parents got my brother and I, who was one-year-old, season tickets to the basketball games at the Fieldhouse. That's cool. So we went to every game at the Fieldhouse and one game I almost got killed. Villanova, I think it was St. Bonaventure, and they weren't supposed to beat them in a buzzer beater. And we just rushed out on the floor, and I went down. And I remember just getting stepped on, and I couldn't breathe.

I had a wind knocked out of me. I was probably like 13, and somebody lifted me up, and I really thought I was dying there. Yeah, that's crazy. And then once in a while we get to go to go to go to go to go go go to go go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to go to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the.... the the the the the the thean.. tooooean.. to the to the to to go to Polester games. But, um. Yeah, it's hard for me to wrap my head around what this, what all this was like in the 60s. Yeah, yeah. It was great, it was great. And it was an altar boy at the church up there.

And, uh, just lots of adventures at Pohmova. I was, uh, I was checking this thing out where did you hung out with Chris Farley? Well, I didn't hang out with them. I interviewed him. So I spent a week on the set of Saturday Night Live and it was the first year that Farley, Sandler, Rock, Spade, those four guys, I feel like there might have been one more. They were a gang, the four of them, and they were looking out for each other. So I was assigned by the magazine I was working for

to do something called On the Set, where you spend a week on the set of a show, and I just write about what it's like to be on the set of whatever popular show they sent me to. So that was fun, because those guys, none of them had egos. This is before they're all famous. They were all, yeah, it was their first season, they were really earnest, believe it or not, and trying to get their break. And I got to choose what was gonna be

the vocal point of the story. And what it was for me was David Spade, had a character that he was desperately trying to introduce as a recurring characterter And it was called, oh fuck, what was it? He played a receptionist and he had a line. And you are, was it, or I can't remember. But they were cultivating that sketch the entire week. So I'd go to the writing meetings, the rehearsals, and he was so excited because he thought it was going to get on. And you know, they do a dress rehearsal first, which is with a live the live the live the live the live the live the live the live the live the live the live the the the the the the rehearsals, and he was so excited because he thought it was going to get on. And they do a dress rehearsal first, which is with a live audience from like seven to 10 or something.

Then they clear out the audience, and they bring in a new audience, and do the live show, and they do extra sketches during the dress to see which ones work best. And his worked really well, but at the live thing, they cut it. And he was devastated. But he became kind of the focal point of the whole story. And then about, I can't remember if it was a couple months later, Chris Rock kind of broke out.

So they asked me to go back and do a feature just on him. And I did the first magazine piece, national piece on Chris Rock. Damn. And so I went there to do him and all the guys kept coming in because they knew me well from the week before and they were busting his chops. I can't remember if that's actually in the story about how they kept coming in and giving him a hard time. But it was fun. But Farley was interesting because he had done one sketch that kind of made him notorious for the first season, which was Patrick Swayze was a host.

And Patrick Swayze played a Chippendale dancer. And he was a dancer too, with his shirt off and he was a, you know. So he's, I'm interviewing him and the subject, that sketch came up, and he started crying. And he said to me, you know, my whole life, I didn't want to be the fat, funny guy. And I was really hoping that they weren't going to go there on this show. But that was my biggest fear of come true. But I to me to me to me to me thuuuuuuuuuuuuuu. thii. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. that I was that I was thi. thi. that's that's that's that's that's that's that's, thi. thi. thi. thi. thi. thi. thi. thi. thi. And I. And I. And I. And I. And I. And I. And I. And I. And I. And I. And I. And I. And I. And he. And he. And he. And he. And he. And he. And he. And he. thin. thin. thin. thin. thin. th. th. And he's th. And he's th. And he's th. And he's th. And he's th. And he's th. And he's th. And he's th. And he's th. And he's the true, but I couldn't turn it down because I wanted that spot. Yeah, that sucks, man. Yeah, and he said I'm hoping that they see beyond that and I'm not the fat guy in every

sketch. And he said it was the hardest thing in the wall for him to have his shirt off on national TV. Oh yeah, dude. I don't want to really liked all the guys. And was Sandler there then too? Yeah, yeah, he was there too. And I went to a photo shoot for them for some reason.

I can't remember like a year or two later. And it was just those four guys, they were just busting my chops and stuff. I think it was because we were the close in age. I don't know, where are they in like their 50s now maybe? Yeah. Yeah. But yeah it was, you know, that was one of the fun parts of that magazine job I had. RIP Farley and Swayze. I ended up doing a cover story on Swayze. Swayze was a beast. Yeah and that was a bad thing too, because I had flown. I had a red-eye flight from, I wasn't living in LA, and I had a red-eye flight from New York to LA, and I went right to the set of a movie he was making with,

I don't even remember what it was called, but he wasn't, so they're finishing a movie and I'm there to interview him about the prior movie that's coming out like in a month. And that was the movie Tu Wong Fu where he played a drag queen with Wesley Snipes and John Legosama. I remember that, yeah. So it was the last day of shooting a film and they shot it at the veterans cemetery this last scene. And you know, so I'm on the set watching watching him work, interviewing the director of the other actors, and then he and I go in the trailer to talk, for usually it's like an hour or two. We talked from, they wrapped it like four or five in the afternoon and we talked about one or two in the morning, and I'm exhausted. And he's exhausted.

And he's the sweetest guy in the world, but he's so... He was really spiritual and into new age stuff and he's talking to me. His dog had died and he started crying about his dog and I'm not very good at comforting people. And then he's telling me that Whoopi Goldberg, who was in ghost with him, had given him this magic wand that she used to, it was like a healing stick and he asked me to hold it and we're holding it to to to to the to the to to the to to their to, their to, their their to, to, their to, their to, their, to, to, their, to, to, to, and to, and to, and to, and their, and their, and to, and to, and to, and to, and their, and he, and he, and he, and he, and he, and he, and he, and their, and their, and their, and their, and their, and their, and their, and their, their, their, their, the new, the new, their, the new, the new, the new, their, their, their, their, their, to, to, toe, toe, toe, toe, toe, toe.e. And, toe. He's, toe. He's, toe. His, toe, toe. His, toe, toe used to it was like a healing stick and he asked me to hold it and we're holding it together and I'm like just oh come on. It's the nicest gun in the world but then he um he was telling me about like a past life or something and I fell asleep. Holy shit. I'm sitting across from him and I hear this Tom Tom I go oh my god and he goes you fell asleep and I said I'm so sorry I told to to to to to to to to to to hold to to to hold to to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold told told told told told told told to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold to hold told told told told told told told told told to hold told to hold told to hold to hold to hold to hold to hold to hold told told told told told told you I told you I told you I told you I told you I told you I told you I told you I told you I told you I told you I told you I told you I told told told this, Tom, Tom, I go, oh my God, and he goes, you fell asleep.

I said, I'm so sorry, I told you I flew in on a, it goes, I'm really boring. I'm like, no, no, no, no, I haven't slept, you know, I'm so sorry. My editor, she's like, I can't believe we give you an A-list cover story story and he was asleep. He was like, like, like, like, like, like, like, like, like, like, like, like, like, tha, I, I, like, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I thi, I was like, I'm, I'm thi, I'm thi, I'm so, I'm so, I'm so sorry, I'm so, I'm so, I'm so, I'm so, I'm so, I'm so sorry, I'm so, I'm so, I'm so, I'm so, I'm so, I'm so, I'm so, I'm so, I'm so, I'm so, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I'm, I'm, I'm, I'm th. thi, I'm sorry, I'm sorry, I'm sorry, I'm sorry, I'm sorry, I'm thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi, I'm thi, I'm that time, he would have been one of the biggest movies stars in the world. Oh, yeah, yeah, he was huge. Then the weird thing was, so the next day, we were done, and the next day he, I went hiking with a friend of mine who lived there, and while he was hiking, he left me a message. And he asked me if I wanted to come out to his ranch and go flying with him. He was a pilot, he was a pilot. thak. thi. thi. He. He. He. He. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was a pilot. He was. He was a pilot. He was. He was. He was. He was. He was. He was. He was. He was. He was. He was. He was. He was. He was. He was. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He was. He was. He was. He was. He was. He was. He was. He was a t. He was, he was a t. He was, he was, he was, he was, he was, I can't get you out of my head and I want to hang more. We're done, you know. So I came back, I didn't have a cell phone then, you know, it was before cell phones or we had them.

I didn't have one. And I got to the hotel and I got the message. And I called him and then my editor called me on Monday and she goes what did you do to Patrick I go what are you talking about and she said he thinks you drugged him or something and she said he said he he thinks you drugged him or something sure but he said he couldn't get you out of his head and he he wanted to be your friend which you don't do with a journalist and he he I I I I I I I he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he was he was he was he to th. th. He said he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he was he he he he he. he he. he he. he the the the the the the the the the th. th. He was th. He was th. He was tm. He was tm tm tb-I tb-I tb-I tb- friend, which you don't do with a journalist. And he wanted to take you flying in the plane and she had to tell him you don't do that with these guys because you know you don't know. The journalist.

Are people like for real like that with you like everywhere you go people are. No, no, that's the only one. Not that I'm saying. No. No. No. No. I. I. I. friend like even if we talk all night long like because you're a journalist or people I'm sure like some of these famous people you know this is different when you're doing big movie stars you know they have to always have their guard up yeah paranoid yeah and you know we could have gone flying the next day and he could have thought it's off the record and hopefully I would have told me oh I'm a a a a the the the the the the I I I I I the the to to go go go go go go go go go go go go go go go go go go go go go go go go go go go go go go go. I'm. I'm. the the. to. to. the. to. the. to. the. the. the. the their. their. they're. they're. they're. they're. they're. their. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I's. I'm. I'm the the the the the the the the the the the the the the the the th. the the the the th. the the the the th. the the the the they're they're they're they're they're they're they're they're they're the the record, he could have said it's off the record, and hopefully I would have honored that, but then he could have told me, oh I'm cheating on my wife, I don't know what to do, I need a beaver or something. It's just not safe. Yeah. And my editor Leslie said to the publicist who was huge, he said, well you tell Patrick that once the story comes out, if he wants to be his friend, they should should he.. he should just he he he he he he he he he to just to just to just to just he should should should should should should he should he should should he should he should he should he should he should he should he should should he should he should he should should he should he should just just just just just he should just he should just he should just he should just, he should he should he should he should he should just, he should he should he should he should he, he, he should he should he, he, no, I didn't have any drugs. I don't, I don't, I don't, yeah.

He was just, I think, you know, his dog had died and he was crying. Yeah. It's the last day of a... You guys bonded. It is the last day of a shoot on a feature, and that always gets these guys emotional, because they're with these people for three months and then they're gone so he was really vulnerable for some reason and maybe the fact that I fell asleep on him I don't know something different happening. Playing hard to get it. Yeah. It's crazy actors are fucking weird it's a weird job that play pretend as an adult. Yeah yeah. You play pretend for like four or five months on a movie and then it's like by guys we're not playing. Oh and now I'm remembering he he's he he he he he he he he he he he he he he he he he he he they they they they they they they they they're they're they're they're they're they're they're they're they're they're they're they're they're th. th. they're they're they're they're they're they're they're they's like. I they's like. I they's like. I they's. I they's. I they's. I they's. I they's. I they's. I they's. I they're. I they's. I they's. I they's. I they're. I they're. I they're. I they're. I they're. I they're. I the the the they. I'm. I'm. I'm. I'm. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi. I'm th. I the they're they're they're like by guys we're not we're not playing anymore. Now I'm remembering he got pissed off at me when the story came out. It didn't say anything to me but the same publicist called Leslie my editor who did assign me the Manson thing you know a few years later but said he's

really upset because Tom inferred that his wife Lisa hadn't hadn't really made it as an actress. And the truth was she hadn't. And I thought I kind of, he got in trouble. Yeah, he didn't like, he thought it was disrespectful or something about how I identified her career. I mean, he said tons of nice stuff about her, I put it all in.

And it might have been like one adjective or something like that. Oh, God. It just pissed him off. I'm, I. And I. And I. And I. And I, I, I, I, I, I, I, I, I, I, I th. I th. I th. I th. I th. I th. th. th. th. th. th. th. th. th. the th. th. the th. that, I that, I that, I th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. th. th. th. th. th. th. th. th. the. the. theu. theu. theuu. thooooooooooooooooooo. thed. thed. that, I th, like aspiring, something like that. Oh God, it just pissed him off. And I'm, I told her, I said, tell him to call me, we're buds, you know, I'll talk about it. Yeah, yeah. How did you wind up going over to like LA from Villanova? Well, I was in New York first. So I was, um, I went to film school, wanted to be a screenwriter. Then while I was at film school, I started studying theater and then decided I didn't want to have anything to do with film. I wanted to be a playwright.

And I wrote a bunch of plays that were not good. And then I had two really bad experiences. One of my plays got selected a one act to be done at the 92nd Street Y. And they had a program where they found the theirfiededededededededededededededed their to to to done at the 92nd Street Y. And they had a program where they found unproduced playwrights. And they matched them with a famous playwright. And it was one night a week for like eight weeks. Each playwright would have his play read on stage. And then this famous playwright would criticize it, not criticize it, but he would, you know,

take it apart and say, this is what you need to do or not. And I I I I I I I I I I I I I I I the the the the the the the the th. And I the th. And I th. And I th. And I thi thi thi. thi, and I thi, and thi, and thi, and th. th. th. the, the, and the, and th. th. th. th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. And th. th. th. the one the one the one the one the one the one the one th. the one the. the. the. the. the. the. thean, thean, the thean, thean, thean, thean. And, thean. And, the. And, th it apart and say this is what you need to do or not and I got a guy named Arthur Copett who was best known for a play, two plays, one play was called Nine which was a musical that won a whole bunch of Tony's, the actor, Kiss of the Spider-woman, what was his, well Julia, was a star of that, yeah, and he played. And then he also did a play called, O-Dad, poor Dad, Mama's hung in the closet, and I'm so sad. It was kind of a cutting edge in the beginning, kind of experimental play. This is like the 70s?

He began the 60s. This is now we're in the 80s.. He. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. to. to-a. to-a. to-to-to-a. to-a. to-a. to-a. toee. to-a. was called Limbo and you know the rooms packed, 92nd Street Y, very prestigious hall and Arthur Kovett says to the audience, you know I teach playwright, playwriting at Harvard and if one of my students brought that play into the class I would have thrown it away. I would have told him the... Damn, dude. And then he went on, it got worse. It's in front of a live audience. A live audience. And it's supposed to be constructive criticism. Yeah, right.

You know, if there's criticism, he had nothing good. That's suicide fuel. Yeah. Yeah. But I was devastated, never wrote a play again. I had a whole bunch of friends of mine from Philly came up to be there like 10 people and they're all it was like awake afterwards. And they never identify the playwright unless a playwright wants so they just know he or she's in the audience and I didn't raise my hand but what I should have done and of course

this happens in the middle of the night when you can't sleep I had the perfect comeback. Of course he had a play that had opened and closed in like three days on Broadway about a month earlier and it was called The End of the World and when I couldn't sleep all night I'm like why where was this rage from why would he pick on somebody like this? How hard why was he so horrible and then I thought what I should have done is stood up in the audience and said I like to Identify myself on the playwright and it's difficult to hear this kind of criticism, but hey it isn't the end of the world Nice land Yeah, I've been the this day never listened to it.

Oh, yeah, of course. Just work out to it. Yeah. You just know it's there. It's probably from 1983 or something or 84. That's Tape City. I should listen to, maybe I'll put it up on my social media. Yeah, right.

And he died about a year ago. Oh, fuck. But everybody, so I ended up working in the theater, not as a playwright, but for a producer. I got to meet a lot of the theater people, and everybody said the same thing. Because I tell some of the people the story. They said the meanest person in the business, theater, and then finished and became a horse and carriage driver in Central Park,

and started just writing anything while I was up there to pass, past time, and I submitted something to a magazine, and it got published, and I'd never taken a journalism class, and I became a journalist, and started getting assignments and got on contract and then the entertainment magazine I was with started sending me to LA a lot to do stories which was great you know they put me up in a hotel. It was when magazines paid a lot of money for stories and they had expense accounts they put me in the Sunset Marquis or the Mondrian I'd have a car and expense account. Chateau Marmont. Yeah. And I go for like a week. And and the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the entertainment. And the the entertainment the the entertainment. And the entertainment the entertainment. the entertainment. the entertainment. the entertainment. the entertainment the entertainment. the entertainment. the entertainment. the entertainment. the entertainment. the entertainment. the entertainment. the entertainment. the entertainment. the entertainment. the entertainment. the entertainment. the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the entertainment.a.a.a. I the the the the entertainment.a.a.a. I the entertainment. I the entertainment.a. I the entertainment. I the entertainment. I the the the the the the Sunset Marquis or the Mondrian. I'd have a car and expense account.

Chateau Marmont. And I'd go for like a week, but I stupidly said to them, because friends of mine, a lot of my friends had migrated from New York to LA, and they'd say, why don't you come out and live here? I said, I don't think I'd ever be happy living there, but I love visiting. So my friends actually got me a lease without telling me for an apartment, because they kept saying, now you have to do it. So I went out for two years and told the magazine, look, I'm going to save you all that expense money.

Yeah, I'm here. They said, great. I mean, once you're living there, that's not, you're not special anymore. But I got there for two years and I was going to go back after two years to New York because I really loved New York and preferred it. And this thing started, so I couldn't stop. You know, and I didn't know it was going to be 20 years, that was going to be going to be going to be going to be going to be going to be going to be going to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, th and th and th and th and threathea, to be 20, to be 20, thoom an to be 20, you to be 20, you to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, to be 20 20, to be 20 20 20, to be 20 20 20 20 20 20 20, to be 20, to be 20, to be 20, to be 20, to be 20, to be 20, thi., thi., thi. thi. thi. thi. thi. thi. th. thi. th. th. th. th. th. th. th. th. the an th. the an the an thi. the an thi. to, weren't you trying to do like a 30th year anniversary? That's how it started. It was supposed to be done in three months after the assignment. And then it got extended a year, year, a year, and I had legally sublet my apartment in New York.

So I, because I knew that my landlord, you guys might be too young, but his name was Peter Sacaro? Did you grow up in New York? I grew up in Queens. All right, Peter Zicaro, who was Geraldine Ferraro's husband. Oh. First woman to run for Vice President in the United States, and her husband, who's, I mean, I'm Italian and my mom hates it when everyone says every Italian's a mobster. Yeah, right. He was in the mob. And he was really scary. So I knew, and I knew that that they they they they they they they they they they had they had that they had they had that they had they had that they had they had they had that that they had they had that they had that that that that that that that that their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their. their their. their. their. their their their. their. their. their. their. their their. their. their their their their th. th. th. th. th. th. th. th. th. th. th. their their their their their their their just changing and they wanted you know they wanted get get us out to raise the rents and we were in rent control but they had to let me legally

sublet it if I did if I did it by the books by the books so I got a perfect guy in there they liked him he paid me I paid them and then when the two years was up and I thought I need like than like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like the the the the the th th the the th th the th the the the the the to to the to the to the the the to the to to to to to to the the the the the the the the the the the the to the to the to to the to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to the the the the the the the the the thi thi. the. the. the. the. the the the the the the the the the the the the the the the the the the. the the them, and then when the two years was up, and I thought I need like another six months maybe to finish this Manson thing. So I called up Max, the guy who managed the property for Zaccaro. I said, Max, I want to do it another two years. Tehray, the guy who's there, he loves it there. He would carry all the old lady ladies groceries up. You know we lived on the top floor of a tenement on Mulberry and everything that will be fine he goes nope he goes you had two years if you're not back you know the first of the month you're getting evicted

so then I had to make the call I could either give up the Manson thing published right away without a story or give up a great apartment on Mulberry Street. I gave up the apartment on Moulberry Street. I. So. So. So. So the the the th. So the th. So I th. So I the th. So I the th. I was. I was. So I was. So I was. So I was. So I was. So I was. So I was. So I was. So I was. So I was th. So, I was was th. th. So, they. th. th. thi. thi. thi. thi. thi. thi. thi. thi. I was was was was was was I was I was I was. I was. I was. I was. I was. I was. So, th. I was was. So, th. I was was. I was. I was. I was the the the the the the the the the the the the the the the th. I was the the th. I was th. I was th. I was theeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee. I was theee. I was thee. I was the. I was the. I was Street. I gave up the apartment on Mulberry Street. You could have still had that. Yeah. Damn. So you weren't a Manson, I don't mean this in a bad way, but like a Manson freak, like the guys that are balls deep in it? Not at all interested. I, uh... That sucks. Never read Helder Skelder. I mean, that said, I have a brother who's eight years older than me and he swore up and down that I was really interested in. He thought I kept a scrapbook with Manson's stories and he was so convinced of it. I went to my friend Dill's house, the one who I think might have the Chamber Brothers. Yeah, right. Because he has all my shit. And I found my scrapbooks from that period and it's all Joe Frazier, you know the Philadelphia Boxer, and Villanova Basketball, Villanova Football, it's all...

It's so cool you still have all your shit, all my shit's gone. Yeah, yeah, I'm kind of a...a lot of writers are the same way. You're scared to throw stuff away. And luckily I have a friend who's generous enough to just let me keep like 20 boxes in his basement. That's awesome. Yeah. But I found the scrapbooks and there's nothing about Manson in there. So I think my brother was high or something. Did you show him? I told him. I told him.

I said, Willie, I don't know what you're talking about. No, no. He goes, you wereK, the moon landing, the man, like do you remember all this? I remember the moon landing like it was yesterday. Okay. I remember JFK and I was only four and I think it really is my earliest memory. And all I remember is, you know, we had to take naps when you're four years old.

Yeah, yeah, I remember. I remember. And I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember. I remember coming I remember coming th. I remember coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming coming down from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from from the the the the the the the the the of the TV crying and she's watching the funeral. And I just kept thing, you laugh in front of the, because we watched cartoon. Why is she crying in front of the TV? TV rules. That was my only memory and then, um, and the moon landing I remember, no memory of Manson at all. Weird. Okay. It might have been because it was a summer. And I. And I. And I. And I. And I. And I. And I. And I. And the. And the. And the. And the. And the. And the. And the. And the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th. te. tee. tee. tee. tee. tee. tee. tee. tee. te. the funeral the funeral the funeral th. the funeral the funeral the funeral the funeral the funeral the funeral the funeral landing I remember no memory of Manson at all. Weird, okay. Yeah, it might have been because it was a summer and I wasn't in school. And I was just playing every day and you know. So, but no recollection. Yeah, my thing with, I got, I got real into the RFK assassination.

And the LAPD of that time, was just bizarre. Like the one dude, there was a guy when RFK got killed that that tha killed that tha killed that tha tha tha tha tha tha tha the tha of that time was just bizarre. Like the one dude, there was a guy when RFK got killed that was a consultant for Adam 12 or Dragnet or something like that. And they were like in Hollywood. The guys named Thomas Redden, I think. But they, like they were, the LAPD was like hand in hand with Hollywood, like working with them with the shows and stuff like that. Yeah, Vince Polio Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li Li li li li li li li li li li li li li li li li li li li li li li li li li li li li li li li li li the the the the the the the the the the the the the the the the the the the the the the the th. There was th. There was th, th. There was th. There was th. There was th. There was th. There was the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th. There was was was was was was was the the th. There was th. There was th. There was th. There was th. There was th. I was th. I was like was like was like was like th. I was like was like th. I was like th. I was like th. I was like was like th. I was like th. I was like th. I was like was like th. I was like the shows and stuff like that. Yeah, well, Vince Boliosi was a consultant from the DA's office for a TV show called, the DA, I think it was called, and he became really good friends with Robert Conrad, the actor,

and he modeled himself after Bouliosy for the TV series, and Buliosi was paid as a consultant while he was a deputy DA. That's crazy. And I for the TV series and Bulioci was paid as a consultant while he was a deputy DA. That's crazy. And I know the copy of your talk, because I did a lot of work on the RFK thing. I've said about, talked about another podcast that I really wanted it in this book, but the book got too long as it was. And since I couldn't tie mostly Jolly West who figures in my mints and stuff and

even not directly everything is circumstantial but I couldn't tie West at all to the Sir Hand thing I looked really hard and I do think Sir Hand was programmed and I do know some stuff that's not reported yet that we'll be in the second book that I found out but it was just it was kind of gratuitous for it would have distracted yeah it would too much yeah yeah yeah it's crazy when I started when I started looking in the RFK stuff like the LAPD hid the evidence they had the the bullets went in and then they just destroyed the evidence and they found out like I well here's a little preview of a social media thing I'm thinking of doing and if if if if if if if I they they they they they they they they they they they they they they they they they they they they they they they they they they the they the they they they the they they they they they they they they they they they the they the they they they they they they they would they would they would they would they would they would they would they would they would they they would they they they they they would they they they they they they they they they they they they they they they they they they they they they they they they they they they they they the the the their their their their their their their their th th the the the the the the the the the the the the the the the the the the the the the the the evidence and they found out. Here's a little preview of a social media thing I'm thinking of doing it. If I say it now I have to do it. But I interviewed

Buck Compton. That's the guy from Banner Brothers. Yeah, yeah. Easy company. Yeah. Yeah. So I talked him on the phone a couple times. Then I had some really tough questions to ask him about destroying that evidence. So I went to Washington state the th th th th th th th th th th th th th th th th th th th th th th thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi th. Now th. Now I th. Now I th. Now I th. Now I th. Now I th. Now I th. Now I th th th th th th th th th th th th th th th th th th th th th th th th th th thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi the. I the. I'm the an the an the an the an the an the an the an the an thi. I thi thi had some really tough questions to ask him about destroying that evidence. So I went to Washington State and interviewed him at his retirement home for a whole afternoon on tape and asked him about that. Because, you know, he said, when he was asked about it later, either in books or news reports, you know, how could he destroy evidence of a second gunman, when Sir Ham was had appeals, you know, after he's convicted, you have a period where you can appeal it, and Buck said it was long

past his appeal state. He couldn't appeal the case anymore. That wasn't true. He did it like within, I think a year and a half of the conviction. Okay. So I confronted him with that, and I, and I, and I, and I, and I, and I, I, I, I, I th, I the the the the the the the th, I the the th, I the th, I th, I'm the the th, I'm the th, I'm the th, I th, I thi thi thi thi thi thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi thi thi, th. th. th. th. th. th. th, th, th, th. th, th, th. th. th. th. th. th. th. th. th. th. th. thi. thi. thi. thi. thi. thi. thi. thi. theeeeeeeeea. thei. theiiiiii. theeeeea. thea. theea. the. the't true. He did it like within I think a year and a half of the conviction. Okay. So I confronted him with that and I'm gonna use the audio and do it. I'll look for it in my social media. Yeah I was just chilling at a bar and then one of the dudes from Band of Brothers was there and then he played Steve McQueen and once upon a time in Hollywood. Steve McQueen was in the Manson era. Yeah. It's crazy shit in my head where I'm like, oh, this is connected.

I never saw Band of Brothers this good or? Oh, yeah. Oh, yeah. I mean, that was horrible because Buck Compton was a war hero. Yeah, yeah. And I actually really liked him. I spent a lot of time, I mean, I spent five or ten years ago. He's a soldier man, if they told him to hide the evidence. Yeah, exactly.

Exactly. Yeah, yeah. Interesting guy. Yeah, it's weird. I don't know much about the Manson thing because it's weird because when you're, I was born in 82, so it's so far, yeah. It was just a myth to me. It was just a guy with a swastika on his head. Yeah. You know what I mean? It was like, oh, that's the devil. And like there was just this whole thing like, oh, hippies are bad. This is what happens when you take acid. Yeah. And like. Well, that's what I, when I went into the, but I never was interested enough to read Helter-Skelter. And I thought it was, I mean, a lot of people mistakenly called a swastika.

It became a swastika, but not until prison. When he was at trial, they all carved exes. Yeah, all the girls had it too. Yeah, but they were just axes. He said we're exing ourselves out of society. was going to trial with a swastika because you know the story evolves after after the time passes but he's the only one that turned it into a swastika and he did that in prison. Okay yeah it's a real weird it's a real weird like the helter sculptor thing it's too much like a movie and then when I started thinking it all these guys are consultants for Hollywood like oh yeah this the stuff it's like they'll the the their their. their. their. their. their. their. their. their. their. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi. It's thi. th. th. th. th. It's th. It's th. It's th. It's th. It's th. It's th. It's th. It's th. It's th. It's is is is. I's is. I's is. I's is. I's is. I's is. It's is. I's is. I's is. It's is. It's. It's th. It's th. It's they. It's they. It's the the they. It's the the the the the the the the the the the the the the the the the the the the the the the the only. the the the only only only only only only one. th. I is just how they did the stuff. It's like, oh, we'll put this out, they'll believe it.

And like, people just get used to that Hollywood vibe of stories. Yeah, yeah. Especially in Los Angeles. Yeah. Yeah. Yeah. It was like, I've never got into like Hollywood. I didn't get into like movies or anything. like and you started bringing up like Coentel Pro and all that in the book it does seem like they just use it like someone like from what I think of what

happened is like someone just went and killed those people and there's just we're blaming on them it doesn't even seem useful to bring them to the Tate house they see like if you're that gone on acid that much yeah like you you can't carry out daily tasks. They were doing speed. I think they were doing speed. You're doing like meth too. Well at trial and this is another thing Buley Osse lied about and I don't hammer it too hard in the book I probably should have. He had to show for the death penalty phase so they all get convicted right. Then they have to. Then there's a whole new phase of the trial, which is just whether they should get life sentences or death. So then you have to argue that they were completely coherent the night of the murders, not under the influence.

If you're drunk or under the influence of drugs, that's a mitigating factor. So you might not have known what you were really doing. So Buliosi talks about it, writes about it in Helter-Skelter. He had to show that none of them were on drugs. And he did that by having Linda Kasabian, his star witness say that they hadn't taken drugs. So they curated, they like made it so that they would get convicted. Yeah, yeah. And they all did get the death penalty. It was overturned a few years later because the state Supreme Court abolished a death penalty in California. But within 10 years, in interviews,

Linne Kasabian said we took speed and the night of the murders. And I think a few years later, she says they were also taking acid. So clearly she lied. That was just one lie, but it's a very important lie, because it earned all of them death sentences. She didn't get it because she got full immunity. Right. And Watson and Atkins later also said that they were on speed that night.

Yeah, Tex. The other guy, Tex, yeah. I found it real weird that they met up with Tex Watson when Dennis Wilson was for some reason hitchhiking. Was there ever a reason that anyone, anyone ever tell you why Dennis Wilson was hitchhiking? Well Dennis was a free spirit and I can't remember the story if it was his car had broken down. I mean I did do a lot of recent because there was something a lot of stuff I didn't buy about the origin story about the Beach Boy Connection. Yeah. The story is that two of the women then then then then then then then then the the the women the the the the women the the the the the the the the the the the the the that that that that that that that that that that anyone ever ever that that that anyone ever that anyone ever ever that anyone ever that that that anyone ever ever that that anyone ever that that that that anyone ever ever ever that that that that that that that that that that that that that that that that that that that that that that that that that that that that the the the the the the the the the the the the the the one one one one one one one the one the one the one one the one one one the one one one the one one one one the one one the one one the an the an the an the one buy about the origin story about the Beach Boy Connection. The story is that two of the women picked him up and then he brought them back, oh no wait. This is where it's complicated. The first time he met any family members were two women

picked him up, he brought them back and fucked them. And then they went back to the ranch and told Charlie. But then he met Watson independently. Maybe Watson, he picked Watson up or Watson picked him up. Maybe he picked up the girls and then Watson picked him up. I can't remember. But a lot of that stuff is more, I think, mythological than factual. It's the kind of stuff that I killed myself thrying to get, you know, just the facts on. And there's so many different versions of all that stuff.

But yeah. I was cracking out, thinking about Terry Melcher and Dennis Wilson trying to fuck all the girls, golden penetrators. Yeah. It seems like a difficult task to try to like interview the, to interview, the, to interview, the, to, to, to, the, to, to, the, and, and, and, and, and, and, and, the, and, the, to, to, the, to, and, to, to, to, to, the, to, to, and, and, and, to, thi, thi, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, and, so. And, to, to, to, the, the, the, the, the, the, the, the, the, th.a, th.a, thin.a, thin, th.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a.a. And, t t t t t test to try to like interview these guys and get the right story because like they are in Hollywood and they all want to be like the main character of whatever happened. Oh I got to turn my thing off sorry I thought I had to turn it off. That's cool. Yeah, they're all out there doing their. Yeah, like I don't know how you can like cut through the truth or not? That's why the thing took so long. And I had to go back again and again and again. And you know, they're usually going to stick with their first story.

Because they know that if they acknowledge that they told a lie, then everything, all the credibility is out the window. Did you try to talk to Rerman Pulaski? Here's the story, the story, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, here, the story, the story, the story, the story, the story, they. the story the story, thi, thi, thi, thi, thi, tho, tho, tho, thi, thi, thi, thi, thi, thi. thi. thi. thi. thi. thi. thi. thi. thi. they. they. their. their. their. their. their. their. their is is thi, thi, is their is thi, is thi, is thi, is thi. thi. thi. thi. thi. theee is thoooooooooooooooooooooo, is thi, is in about a year or two into this, I really wanted to talk to Polanski, and I reached out to, you know, I did interview Gene Ketowski, who was a Polish producer of his earliest films, one of his very close friends,

a guy named Victor Lowndes who started Playboy with Hefner, who was one of his closest friends. So three or four of them told him that he should talk to me. And he never was going to reach out to me. But then I called Andy Bronsberg, who has been his producing partner, had been. I think he still is, for like 30 years. And they said, the only way Roman will ever talk to you is if Andy OK is it. So Bronsburg bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze bronze. to to to to to to to to to to to to to tooomomeomeomeome talk to you as if Andy okay is it. So Bronsburg was in Los Angeles. He lived in Europe too, but he was coming to LA and for business

meetings, Rome is not allowed in LA. So he said he'd give me 15 minutes at like the Beverly Hills or whatever hotel he was staying in Beverly Hills, no more than 15 minutes. And the only reason he did it was because Lowndes and Gattowski and these other guys said just give the guy a break break he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he. he. He. He. He. He. He. He. He. He. He. He. He. He. He. He. the the the the, he. He. He. He. He's their, he was, he was, he was, he was. He. He. He's, he was, he was, he was, he was. He's. He's. He's. He's. He's. He's. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. the, he, he, he, he, he, he, he, he, he, he, he, he, he, he. the, he. the, he. the, he's, he's, he's, he's, he's, he's, he's, the, the, the, he was, he was. the, he was. the. the. the. the. the. the. the. the. the.. And the only reason he did it was because Lowndes and Gattowski and these other guys said, just give the guy a break, just hear what he has to say. So he did, and it turned into about two, three hour meeting. Okay. Yeah, and I think, because I started showing him stuff. And he became more and more impressed.

And he said, all right, Roman's gonna want to know tho th. th. th. th. to know to know to know to know to know to know to know to know to know to know th. to to to to to to to to to to to to to to to to to to to to to to to the the to the to the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the he. he. he. he. he. hea. hea. hea. to be. tooome. tooombea. tooombea. tooombea. tie. tooomorrow. tooomorrow. tooomorrow. tooomorrow. tooombea. hea. he.tell him to talk to you and he will. Obviously you have to come to him. He can't come here. And you only get one shot because he can't talk about this twice. It's too upsetting for him. So you've got to wait till you have all your ducks in a row when you're at the very end of it, then get in touch with me and we can set it up. And then that never th in th in th in th in thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu to thu to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to the to the the the the the the the the the the the the the the the the the their their their their their their to. tou. tou. tou. tou. tou. te. tou. te. te. tou. te. to. to. to. to. to. to. to I never got my ducks in a row. Yeah, the ducks are still coming. Yeah, they're still, but then around 2015 or 16, when I would have been ready to go see him, he had already had that incident where he was detained in Switzerland or somewhere in Scandinavia. He was on vacation or at a film festival, and the authorities held him there for about a month or two for in-house detention while the United States tried to bring him back. So they're still trying to get

them. They're still trying to get him and this happened in like 15, 16, 17, and that was such a humiliating experience for him. I don't think he's ever done an interview since. And you know, now he can't get his films released in the States because of the Me Too stuff. So I've now, I mean, I still would like to talk to him and I probably lost my chance. Although Debertade, who Sharon's sister said, any time I want to, she'll tell him to do it and he'll do it. Damn, that's a fucking trunk card. Yeah, yeah, so the problem is, I shouldn't say this on our podcast, but what I want to ask him is not what he wants to be asked and he's going to be furious. So now I have to consider using her to get to him. I'd probably go back, I mean, all the other guys are dead. Gatowski, Lowndes, all his friends, but I'm pretty sure Brownsburg is so alive so I checked like once a year. So I could go back to him. I don't know if, I don't know if Polansky would talk to me. He just turned 80 a week or two ago and.

Yeah, it's the one thing that sucks about this. Like, were you, was Jolly West alive when you started? No, no, he died. I thi he, I he, I he, I he, I he, I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I thi. th. th. I just, I just, I just just just th. I just just just just just just just just just just just just just just just just just just just just just just just just just just just just just just just just just just just just just. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I tied. tried. tied. tried. tied. tried. tried. tied. tried. tried. tied. he. he. the assignment and his name didn't pop into my consciousness until about a year and a half later. And I, you know, I think it's in the book or I've talked about in podcast. I had actually interviewed him by some weird coincidence. No way. Yeah, yeah, yeah. Like five years before I began the Manson thing. Like I said, I was in New York and they'd send me to LA, so I did a story on celebrity stalkers, people who are obsessed with celebrities and stalk them

and try to kill him often. And he was an expert on all kinds of violent crime stuff. So he had done lectures, might have written something about celebrity stalkers. So I set up an appointment with this guy at UCLA and went to his office. He wasn't there. His secretary left me in his office. And she said, he should have been here, but just wait.

And it was like 45 minutes, just sitting waiting for him. He's late. Comes in, doesn't apologize. What do you want to know? So I start to say, well, it's about, and then it was like I was a class and he's lecturing and I try to ask him a question, he said, I'm talking. And I'm like, what a pomp of his size. So at the end of his talk, I asked one or two questions and it was all like pedantic, stupid. And I said, thanks, thanks, thanks, thanks, thanks, thanks, thanks, thanks, thanks, thanks, thanks, thanks, thi, thi, thi, thi, thi, thi, thi, thi, thi, I'm thi, I'm to to to to to to, I'm to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to th, I, I, I was, I was, I was, I was, I was, I was, I was, I'm, I'm, I'm thin, I'm thin, I'm thr-a, I'm try.a, I'm try.a, I'm try and I try the.a, I'm to ask, I was like, I'm to ask, I never even transcribed the tape forgot about him until you know three four or five years later when all of a sudden he's

popping up as like a ghost and I'm like I met him an interview you know I had the tape transcribed and there was nothing in it useful for my purposes but I have it still yeah I watched a weird Manson interview with Reagan's son yeah I've seen that and Reagan loved Jolly West it still. Yeah I watched a weird Manson interview with Reagan's son. Yeah I've seen that. And Reagan love Jolly West and they did like some weird like California study on violence. Yeah. Study of the center for the reduction. And he did the false memories. Yeah. Yeah. Jolly West was in a false memory. So that's all to me that's the M.K. Ultra. We're shit. Well that's what he that was like one of the more shocking parts of the book

was the Jack Ruby stuff yeah yeah that's jolly West like went in tape is gone yeah and then next thing you know yeah this guy's sputtering stuff about Israel yeah yeah yeah yeah this guy's sputtering stuff about Israel Yeah, burning Jews under the capital. Yeah. Yeah. That's wild. Yeah. Now you had access to his archives, right? Everybody has access. It wasn't made just.

I thought you sort of. I got it first because nobody had asked. So he, when I found out he died, so immediately. Are you the guy that found that him and Sidney Gottlie had had code? Oh, yeah, no no no no, Richard Holmes right? No, no, Sidney Gottlie? It was Gottlie. Yeah, no, so what happened was,

all right, so first what happened was, once he starts appearing in too many different places where Manson is, and then I start looking him up, and I see, I never heard of M.K. Ultra. And I see what it was, I research it, and then, and th, and th, and th, and th, and that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that, that that that that that that that that, that, thi, th, that, that, that, that, th no, th no, th no, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was, was the the the the the the the the the the the the the the the the the the the the the the the the the they, was they, was they, was they. Was, was thi. Was they. Was they. It was they. It was they. It was they. It was they. It was thi. It was, was thi. It was, was, was they. It see, I never heard of MK Ultra. And I see what it was, I research it, and then I see that West had been accused from the day it was revealed of being one of the chief scientists, and he went to his grave denying it. Nobody ever really investigated it. Nobody ever proved it. So I contacted UCLA because I knew that was his last school. He'd been there was his last school. He'd been there for like 30 years.

And usually they donate their papers somewhere and usually it's their university, the last one they're at. So they said, yeah, we have everything, it's just not been processed. So then it was still, I mean it was still a magazine story, but it was like a year-long thing, year and a half, and I said said could you expedite it and they said you know normally we don't but I just guess I got the archivist I or the woman in charge of special collections on a good day she said we'll do a couple boxes at a time for you so I went in the entire summer and they would have a couple boxes every few days and it was just looking for anything and I found

correspondence between West and someone named Sherman Griffi. And the correspondence sounded like people setting up MK Ultra, experiments, how to hide it, how to keep it from his colleagues. But it wasn't a name, but I sounded familiar. So then I went, there were only a couple books Especially back then in the late 90s about M.K. Ultra were you like out there? If you were like talking about M.K. Ultra like were you out there like were people think like a little like crazy? Oh, yeah, they still do. Yeah, kind I mean, the people are talking about a little thooo the thu. Yeah, th. th. th. th. th. th. thu. th. th. th. thu. th. th. th. th. thu. th. th. th. th. th. th. th. the th. they. they. they. their their they. they. their their their they. they. the they. the the the they. they. they. they. they. they. they. the the the the the the the the the the the the the the the the the the the the the the the the the the they. they. they. they. they. they. they. the they. the the the the the the the the the the the the the the the the the the the the the the th. the th. the the th. the the mean, the people that talk to them. A little less so now. Yeah. But, yeah, so I found, I mean, I had John Mark's book, which was the first one, in the search for the Manchurian candidate.

And it's in the index, Grifford Sherman. And it's not even in the main narrative, it's a footnote I think, in the footnote section where he says Sherman Griffith Rifford was an alias that Sidney Gottlieb used in correspondence with certain researchers. So that was like goal because that meant that it was Sidney Gottlieb. OK. And I took that stuff. I took all the documents that I was able to copy from the archive. I think I got about 20 pages of letters. I brought them to John Mark Mark Mark Mark Mark Mark Mark Mark Mark Mark Mark Mark Mark. the. the the the the the the the the the the the th. th. th. th. th. th. th. th. I. th. I. I, th. I, th. I, th. I, th. I, th. I, thi. I, th. I, th. I, th. I, th. I th. I th. I th. I th. I, th. I, th. I, th. I, that, that, that, that, that, that, that, th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. I th. I th. I th. I thooooooooooooooooooooooo. I th. I th. I th. I th. I th. I th. I th. I th. I th. I think I got about 20 pages of letters and I brought them to John Marks who you know he was a whistleblower who discovered. Is he the guy that

wrote searching for the mentoring? Yeah so he had worked for the State Department just like in records or something and he found financial records for M.K. Ultra. And started looking into what this was and it had never been publicized. And then he contacted someone in Congress or something, or maybe Seymour Hirsch, I can't remember. But he was a reason it became known. And I brought all this to him, and he had stopped doing interviews. So, Search for the Minutarian candidate came out in like 77, I think. And he never wrote about that again, and he stopped doing interviews about the subject around 78 or 79. So when

I they told him. Well no no no so I reached out to him this is the late 90s and he wouldn't he said I don't talk about that anymore I think these were emails and then I told him what I had and he said all right if you want to meet me let me ne next the you the you you you you you the you you you the the the the the the the the the the tip the the tip tm you the the tm you tm you tm. tm. I tm. I tm. I to to to to to to to to to told. I told. I told. I told. I told. I told. I told. I to to to to to to to to to to to to to to to to the the the the the the the the the the the the the the the the the the the the the the the the the the they. I they. I they. I they. I they. I the tm. I'm. I'm. I'm. I'm. I tm. I tell. I tell. I tell. I told. I told. I told. I to. I to. I to. I told him what I had. And he said, all right, if you want to meet me, let me know next time you're in DC, because he lived in Georgetown. So I told him I was going to be in DC, and it was the night before Thanksgiving. He told me to come by his apartment at 11 o'clock at night. And I went there, and he lets me, and I think it's in the the their, and I, and I, and I, and I, and I, and I, and, and, and, thi, thi, thi, thi, thi, thin, thin, thin, thi, thi, thi, thi, thi, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, ti, tom, tomorrow, tomorrow, tomorrow, tomorrow, tomorrow, tomorrow, tomorrow, tomorrow, tomorrow, tomorrow, ti, ti, ti, the book, the scene, where he opens the door, and he barely even says hello to me.

He just says, what do you have? And he puts it on his dining room table and he looks at it, he's like, I've never seen anything like this. He's like, I've never seen anything like this. I've only seen thrown. I've never seen anything this complete. different. So then we talked a little bit and I said why do you not do it? He goes, after the book came out he said my life was ruined. I had people camping out on my front lawn. Oh yeah. And he said you're going to have the same thing and sure enough. I mean I get emails I get emails every day but probably every second or third day from people who tell me they were subjects of M. K. Ultra experiments or their father was or their father did.. I. I. th. I. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi th thi. thi. thi. thi. th. th. thi. thi. thi. th. th. th. th. th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th. th. th. th. th. th. th. thi thi thi thi thi thi thi thi thi. thi. to to toeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee thi thi thi thi thi thi tell me they were subjects of MK Ultra experiments or their father was

or their father did them to other people. I'm the only one that can help them. Really long crazy, crazy letters. Luckily nobody's shown up in my house. Some people have found my personal phone number and called me and stuff, but nobody's shown up yet. I think there's a thing with like Watergate and Richard Helms where I've read this one book th. th. th. th, th, th, I th, I th, I th, I th, I th, I'm th, I'm th, I'm th, I've th, I've th, I've th, I've th, I've thied thied the, I've the, I'm the, I'm the, I'm the, I'm the, I'm the, I'm the, I'm thee, I'm their, I their, I'm their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their the, I'm the, I'm theat, I'm theat, I'm that, I'm theat, I'm theat, I'm theat, I'm theat, I'm the o' the o' the o' theat, I hope they don't. I think there's a thing with like Watergate and Richard Helms where I've read this one book I know it's definitely a limited. Oh yeah, Helms was involved.

Yeah, Helms. There was a meeting between Nixon and Helms and, uh, what was his name? Bob Haldeman, who was like his chief of staff. Haldeman. And Nixon said, I think the haldlderamamamamamamamamam in in in in in in in in in in in in in in in in hand hand halderman in halderman in the halderman in the halderman in the halderman in the halderman in the halderman in the halderman in the hilderman in the hi. I the hi. Ialdeman? Haldeman. And Nixon said, I think the Haldeman in front of Helms, that if this watergate thing blows, he goes, I'm gonna let, it was some. He knew, he was way, when Nixon was way back, big stuff. Yeah, yeah. But he, this was about the Kennedy assassination. He said, we're gonna blow, expose the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the haldioldera, the haldiolderderylde, the haldie, the haldie, the halde, the halde, the haald, the haald, the hald, the halde, the halde, the halde, the ha halde, the ha ha ha ha ha ha ha haald, the hald, the hald, the hald, the hald, the hald, the halde.halder, the haldem, the haldem, the haldeman, the haldeman, the haldeman, the haldeman, the haldeman, the haldeman, the haldeman, the haaldeman, the haaldeman, the haaldeman, the haaldeman, the haaldeman, the haaldeman, the haaldeman, this was about the Kennedy assassination. He said, we're gonna, I'm gonna blow, expose the Kennedy assassination connection to the Bay of Pigs and Cubans. Yeah, so he knew and that was something.

Was the one guy from your book, Reeve Witson, was he Bay of Pigs? Was he going to Cuba? You know, I couldn't document anything, I never met him. He was dead, too. He told people that he that he that he that he that he was that he was that he was that he was that he was that he was to Cuba? You know, I couldn't document anything that I never met him. He was dead too. He told people that he was part of all these operations. Okay, right. But every four, there's no paper record of him anywhere. And every foyer I said was, we can neither confirm nor deny.

Do you know the author Jefferson Morley? I read, what do you think about that,? I mean he and I have communicated by email he wanted me to go on his podcast does he have a podcast? He's starting a podcast on JFK I don't know if it started yet but I read two of his books and I know I read a. I read a book on Angleton and this book called Scorpions Dance about the like he's you know DC kind of a guy watching Post I love the waive. I love the way like I liked. I like like liked a the the the the the the the the the the the the the the book I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked liked a th. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I liked. I the book a book a book. I the book a book. I the book. I the book. I the book. I the book. I the book. I the book. I the book. I the book. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I ions Dance about the war like the battle between Helms and Nixon during Watergate yeah and he like Helms destroyed all this all this MK Ultra stuff yeah like he spazzed and hit the button was like I'm getting rid of this yeah so I don't know no one knows they just have the financial records only records are you the ones that you found of Jolly West and the ones that mark what's the name of got. I I I I I I I I I I I I I got got got got got got got got the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the that that that that the the the the that that that that that that the the the the the the the the the the the the the the only the only the only the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the they. the the the the the the the the the the the the the the the the the olly West and the ones that Mark, what's the name, I forgot his last name? Gottlieb?

The, the, the, the, the guy that wrote, searching for the Manchuration. Oh, John Marks. John Marks, yeah, those are the only two paper records that they have, right? Yeah, yeah, it's because, I mean, no, there could be others that nobody's, they... preserved. What happened was he had so many boxes that he must have left them in accidentally and he never went through everything obviously or he would have destroyed it. And when the graduate students who probably got the job for, you know, ten bucks an hour to go through it, went through it, they didn't know what they were looking at. Yeah, they don't know. Helms shredded everything.

Yeah, yeah, he and Gott got got got got got got got got got got got got got got got got got got got got got got got. These, they. These, they don't know. But Helm shredded everything, right? Yeah, yeah, he and Gottlieb shredded everything. So West, these were one-way correspondence. Every letter was from Gottlieb to West. I don't think I have any from West to Gottlieb. But there must have been other researchers who probably were better at destroying stuff than West was, but who knows, maybe some, you know, James Hamilton, who was as in deep as Jolly was in San Francisco, maybe his wife has boxes. I mean, I contacted a lot of these people to look at archives and they all told me they don't have anything. Okay. But they could, you know, there could be more

stuff. Yeah, it's crazy. I think it's a, there was a dude, there was guys that ran the CIA that didn't even know MK Ultra. Yeah, they compartmentalize it. William Colby said he had no idea. Colby, the dude from Bechtel, the guy. Bissell. Um, are Robert Kennedy called, Bobby Kennedy called him, oh, John McCone. Yeah. Bobby Kennedy called him right after the JFK assassination assassination assassination and was like did one of your guys do this? Yeah, like straight off the gate and they all end up working for Bechtel in the 80s when Reagan's president. I don't know what

Bechtel is. Bechtel is this big company that they like went over, they went over and like build up China. They're like a huge. They did the cleanup for the nuke plant up in Mechanicsburg, wherever that was. Three Mile Island. Three Mile. They're like a Dickinson. They're like a big infrastructure company. But all these guys end up in the Reagan, like George Schultz, I think the guy's name is, they all end up in the Reagan administration in the 80s. So after they get out of CIA type stuff, they all got jobs. Yeah. Yeah. And I don't the the the tho tho tho they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they they're they're they get they get they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're they're th. th. th. th. th. thi. thi. thi. the. thi. thi. the. thi. they're like. they're they're was just at UCLA, but I know Reagan had him doing some weird violence study thing that's kind of controversial. Yeah, yeah, that's in my book. Yeah. I've got a whole bunch

of pages on that. The stuff that freaked me out was the stuff they were doing in a hate and Ashberry about the like just giving free care to ever the clinics and everything was free and all those like hippies are just like going in like oh this is free and like it's an experiment yeah Charlie Manson said they're like dude this shit is not free like they are fucking with your head right right yeah I mean the one good things but one of them is I do get approached by people who are serious researchers or who are people who have a history with stuff who for the first time are ready to share things. So I am getting a lot of information from people connected to that who I wouldn't have

found if my book hadn't come out and they hadn't found me. When you were doing it at the start and it's still just an article, what's too long? What's like the standard where you're saying, oh now I'm going a year and a half in? Like what's the long? Oh, everything was too long. Like what was it originally? What was the original timeline?

Three months? Yeah, no, so I got the magazine say like, all right. So I got the assignment the day after the, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, I, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, th, th, th.... th. th. tho, the, the, the, the, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, the day after my birthday, which was March 21st, and the deadline, I have the original contract, I haven't looked at it for a while. It was probably, so it was for the issue that comes, it's called the September issue, but it comes out in August. So magazine, monthly magazines, which is what Premier was,

it's always, whatever month is on the cover, it comes out the month before that. So, they they they they they they they they they they they they they they they they the the the the the the the the the the their their their, their, their, the the the the the th, so, th, so, th, th. th. th. tho, tho, tho, tho, tho, th, th, th, th, th, th, th, th, th, th, th, th, th, the, the, the, the, the the th, th, th, th, th, the the the the th........ the the the the the the the th. the th. the the, the the, the, the the. thean, thean, the thean, the threateeeeeea, thean, thean, thean, thean. ththat. So they wanted it to come out for the August 8th, 9th anniversary, so they would have needed the story by the latest by probably early June, because they had to lay it out and get pictures and fact check and all that. So it was of March, April, May, three months. I was supposed to turn it around. And when I didn't do it in time for the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary the anniversary, the anniversary, the anniversary, their, their, to come, to come, for to come, for to come, to come, to come, for to come, to come, to come, to come to come to come to come to come to come to come to come to come to come to come to come to come to come to come to come to come to come to come to come to come, to come, to come, to come, April, May, three months. I was supposed to turn it around. And when I didn't do it in time for the anniversary, Jim Megs, who was the editor-in-chief, started, he didn't come out just to see me. He was coming out to LA anyway.

So I'll never forget that day. And I might have written about in the book. I can't remember what ended up in and about. and what it about, but I spread everything out on the floor of my apartment and he was like a kid and I mean he was so excited. Okay. He goes, we're going to blow the deadline, just keep working. That's in the book. Yeah, and then he let me do, he paid me for almost two years monthly to just keep reporting and then he got fired probably because of this.

So too long was ever, once you miss the first one, it doesn't happen. I mean, nobody would ever do that. Is it like a career ender? Well, he ended up recovering because he went to Popular Mechanics. And this is where a lot of conspiracy people come after me. Because he won a national magazine award, a popular mechanics. They did a big, one issue just on 9-11. Yeah. It's a famous cover.

It's a famous. Yeah. And the issue was that, you know, the buildings fell because of the plane crash. So all these people once they found out, because I'm pretty sure I named him in the book. His name might only be in the acknowledgment, his full name, but they're all like, so you he was part of that so he was probably setting you up

So you're compromise Yeah, exactly no, but I love the guy. He's great and he helped me and I don't know about that other stuff But he won all these national magazine awards there and he's a really you know, he's a nerd, you know, he's just he was a nerd, he was a nerd, and this was what he got into journalism for was my thing. tho. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. the the he. he's he's he's he's he's he's he's he's he's the the the he's he's he's the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the guy. Yeah. Yeah. the guy. the guy. He's the the guy. He's the the the the the guy. He's the the the th. He's th. He's th. He's th. He's he's thro. He's th. He's hea. He's he's he's thr-he's thr-he's th. He's the the the the journalism for was my thing. Unfortunately, he didn't get any of the fruits of it, might have lost his job. Yeah, right. But things worked out OK for him. Can I ask you, we know what too long for the timeline is, but like what, do you have any idea as a magazine article, how long a piece would have been?

Yeah, yeah. Well, by the time it, by the time we got past the first deadline and they saw the material, it was going to be a two-part series. Okay. It could have gone to three even, who knows. We just, so usually, I mean, I was famous at all my jobs for turning in about 1,500 words too many. And my editor, Leslie, who was the only woman I ever really worked with, would just, don't give, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, the, don't, the, the, the, the, the, the, the, the, the, the, the,, who was the only woman I ever, editor I ever really worked with, would just, don't give me 6,000 words on a 3,000 word assignment. I'm like, then you can just cut, cut, cut, cut away. And then she always ran my stories long, which was a huge compliment to me. Yeah, right. And so this thing was probably a sign for 5,000 words because it was a big feature. And what they would have done was th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, thi, thi, th, th, th, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't, don't th, don't, don't, don't th, don't th, don't th, don't th, don't th, don't th, don't th, don't th. Don't thi, don't thi, don't thi, tho, tho, tho, tho. Don't tho. Don't tho. Don't tho. Don't tho. Don't tho. Don't thoo. Don't tho. Don was they could have run it as long as six or seven if they thought it was going to be newsworthy they would run it long and if they had to they do two

three you know a series. So when you're at this book you have so much more there's more for another book or yeah yeah yeah are you still looking no I'm not going to I have a lot of other stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff stuff I think is really interesting that didn't make the first book, but I'm not doing a second book unless I get really definitive stuff that doesn't leave anything hanging like the first one did. Do you have any interest in another subject? I really want to and I keep thinking just put this aside, but I can't until I get this out of my system. Okay, I got you. So Dan, who you met, my collaborator is really pestering me, but luckily he's got two other book contracts right now and he just got hired by Harper's magazine to be their book reviewer, you know, so

he's really, really busy, thank God, he's off my back. But, you know, I only will do it with him because we had such a perfect working relationship. And the guy's a machine. And he knows exactly, he knows my thoughts before they come out and he knows how to help me. Okay, sweet. Yeah, so he'll do it with me. But I told him, I said, I still not, I'm getting stuff and I'm still not happy that I have enough for the second one. How many quits have you had along the 20 years of trying to do it?