Werewolf Ambulance: A Horror Movie Comedy Podcast - Episode 474- Late Night with the Devil (2024)
Episode Date: April 29, 2024In this week's episode, we're discussing a brand-new film that has had the internet abuzz-- 2024's "Late Night with the Devil." Special topics for your consideration include: Katie's great new ideas f...or a one woman show along with some new employment opportunities, Allen dropping knowledge on ye olde television shows, loosely factual historical nonsense, and a demon whose name might be a demon and miiiight be a medication for lactose intolerance. Do you like modern horror movies that are set in the 1970s (I know, kind of grasping at straws here because this movie is fairly dissimilar to most of the other ones we've covered)? You may enjoy Episode 96- "The Conjuring," Episode 175- "House of 1000 Corpses," Episode 268- "The Love Witch," Episode 282- "The Amityville Horror" (Ryan Reynolds version), Episode 286- "Knife + Heart," Episode 394- "Black Phone," and Episode 396- "X." The regular lineup of links! You can support us at patreon.com/werewolfambulance where you can listen to nearly 50 episodes of our action movie podcast with a new one coming every month! This month, our Patróns have chosen "The Fifth Element." leave us a message at 412-407-7025 hang out with some cool listeners at https://discord.gg/DutFjx3cBD buy merch at www.teepublic.com/user/werewolfambulance the best place to reach us is at werewolfambulance@gmail.com we're on Reddit at r/werewolfambulance sorta on Twitter @werebulance sorta on Instagram @werewolfambulance www.werewolfambulance.com if you feel you really must lodge a complaint with us, please do it on Facebook at facebook.com/werewolfambulance because we are probably not gonna see that, ever.  If you liked this, please leave us a review on Apple Podcasts or wherever you listen! It helps others find us and allows us to continue to grow. Intro song is by Alex Van Luvie Outro song is A. Wallis- "EMT" Seriously, we have the best listeners, hands down.Â
Transcript
Discussion (0)
the world of ambulance starring Katie
the
today, hey Katie, welcome to another episode of wherewolf ambulance starring Katie.
And Alan, Alan, thank you so much for having me here on your show wherewolf ambulance ambulance.
Hey, Katie, thanks to another episode of Wherewolf ambulance ambulance.
And Alan, Alan, thank you so much for having me here on your show. Hey Katie, welcome to another episode of Wherewolf Ambulance, starring Katie!
And Alan!
Alan, thank you so much for having me here on your show, Wherewolf Ambulance.
Oh, I love a 70s talk show.
Bada-da-da, da, da, da, da, da, da, da, da.
Did you watch a lot of late night TV?
Sure. Really? Yeah. Yeah, for sure.
What did you like to watch? Uh, Letterman. Letterman was my shit back in the day. Okay. Because it was goofy, maybe
silly and then like, sponge would play. Hell yeah, sponge. Yeah, 16 candles is a fucking-
fucking. That guitar riff at the beginning. Rips. I'm thinking of Plowd. No, I'm not. No, I'm thinking of that little
upbeat, like little bit at the beginning of 16 candles.
Molly.
Yeah.
Plowd is also a fucking joke.
Oh yeah.
That rules.
Yeah.
Let's talk about sponge.
That album with like the guy's head and the candy corn on the cover. Oh, I feel like every album from the 90s had a th. th.ilted and then like an non sequitur of an object.
Item. Yeah. We need a tilted head and an item. And like a TV? Yeah. Yeah,
perfect. Kill your television by Detsatomic Dustbin probably fits right in there.
Oh, Nezatomic Dustbin. Yeah. Grey. Yeah. Grey, cell green. Yeah, it's a good jam. It's a good jam them and two other bands. What does Grebo mean?
It was just like, it was what their little niche genre was called.
It was like, them, Carter the Unstoppable Sex Machine and some other band?
I do not know that.
Yeah, Grebo.
They were like, they were like punk adjacent, but they wore a thrown.
Yeah, yeah. Yeah, that's a thiiiiiii. thi. thi. thi. thi. thi. thi. thi. thi. thi. The. The. The. The. The. Thea. Thea. They. Thea. They their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their, their, their, their, their, their, their, their their their their their their their their their their their their their thi. T. T. thi. theeateateateate, theateatea. their thea. their their little little little little their their their their thebo. Grebo. If there's only three bands making up a genre, is it really a genre?
Yeah, 100%?
Yeah.
Yeah, I feel like one band can make a genre, especially in this day and age.
Speaking of genres and bands,
I need a good pun for a ska band that's based on having your tits out on the beach. Ooh, it's okay if you can't come up up th th th th th that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that th the the the the the the thi thi thi thi thi the thia thia thia thia thia thia thia thia thia thi th now, but think on it and get back to me.
Scoogling was the first thing they came to a lot.
Scoogling is pretty good.
There's more to it.
There's more behind there.
There's more than I need to get into.
I feel like in scoogling the logo would just the two o's eyes, it's fine. I got kicked out of a hooters once.
For what?
Oh, it was Kaysom's called.
Pazin threw something at me and we were asked to leave.
I got kicked out of a subway once.
What did you do in a subway?
We were stupid teens and my friend was fucking around and like hit the ice machine so that ice fell out and the guy working behind the counter who looked like Gene
shallot the movie critic. Okay. Thought we were stealing the the baked cookies that
they had at a subway. And he's like you guys are bad you can never come back here
and was like tomorrow I'll be here for my six-inch meatball
somebody so come up.-inch meatball subilly so come out of the subway meatball subs smell like vomit that is all yeah and they were like a
dollar and delicious well anyway late night with the devil
with the devil starring David Desmoutian Pennsylvania's own
Allentown Allen's Town there you go we're living here in
Allentown yeah Pittsburgh. You should, I mean
there is a neighborhood in Pittsburgh called Allentown. There is. You should start a band in
Pittsburgh called Allentown. There's a band in Pittsburgh called Allentown with the five other
Allen. Why? I'm not sure to be O-town that, Alan Hallda, Alan Hallda, Alan Hall five other Allen. Yes, I will manage you. Me, Alan Alda, Alan Hale, other Allen.
No, I want them to be nobody's.
I want you to be the most famous one.
What was my boy band gonna be called?
Never had a boy band for a while?
Yes. Was it boy town?
Was it boy town?
Was it boy town?
It was boy something.. Yeah, tha, thoy, tha, boy, boy, boy, boy, boy, boy, boy, boy, boy, boy, tha, boy, boy, th. Yeah. Yeah, boy, tho, boy, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, th. I I I. I. I. I. I, th, th, th. I. I. I. I. I. I, th, th. I. I. I was, th. I was, th. I was, th. I was tho, tho, tho, tho, tho, tho, tho, tho, tho. tho. tho. thooooooo. tha. thoooooooo. tha. thoo. tho. I was tho. I was th Town. It was Boy Something. Pretty sure it was Boy Town. Yeah.
Um, wow.
Anyway, back to Late Night with the devil.
This movie,
I was very excited about this movie.
Yeah.
I heard about it.
Because I, like, I have a deep, like, you asked me about late night TV shows.
I have a deep love for watching old clips of the Dick Cavett show. Okay. Because like like like like like like like like like like like like like like like like like like like like like like like like I the th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I don't th. I th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I thi. I thi. I thi. I thi. I thi. thi. thi. thi. thi. thi. thi. thi. thi. of the Dick Cavett show. Okay.
Because he would just like have like Gore Vidal and Muhammad Al Eon and be like, I don't
know you guys talk.
And it was fascinating, like just hear like interesting people talk to each other.
Like a salon.
Yes.
Yes.
And as a like total old man want to be intellectual, like that stuff fascinates me.
I can see that being really appealing.
Yeah, and then like you add like, I know that David Dussmowshin is like,
like super into horror stuff.
I've never heard of this man before today.
He is a character actor.
He's been in a bunch of like Marvel movies and DC movies.
See, that's why I don't know him. Exactly. Oh, his hair really like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, like, like, like, like, like, like, like, like, like Marvel movies and DC movies. See that's why I don't know him. Exactly.
Oh, his hair really looks like that. Yeah. I thought, wow, his just for men is showing.
No, that's what it's great. I'm going to pretty sure he dies his hair because I think he's
around my age. Let's see. Like holding on to that much black would be a fucking feat in and of itself. Oh truly. He's done comic books about like a horror host and he's super into like genre stuff and he hangs out
with this I can't remember the name of the band but there's like this sort of like
50s sounding rockabilly band that's like a husband and wife that do like songs
about Satan and he hangs out with them. Okay all right. They like tore with like Rob Zombie or something recently. Of course they. they. they. they. they. they they. they they they they they they they they they they they they they they they they they th. th. th th th th th th th th th th th th th th th th th th th thi thi thus thus thus th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th th thi thi thi thi thi thi thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu thu Satan and he hangs out with them. Okay, all right.
They like tore with like Rob Zombie or something recently.
Of course they did.
Who else would tour with Rob Zombie, Robert Zombert?
So he's super into it and I was like,
oh man, I'm stoked for him to get to do this solid breakout thing.
And apparently now he's doing a TV show called Grave Encounters, I want to say. Maybe I've got that wrong. Wait, Grave Encounters was that Canadian movie?
Oh, I loved that.
I hated it.
But it's, he's doing a talk show where he interviews people
while they're both laying in coffins.
Because it's funny.
What?
I mean?
Okay, it's a gimmick.
I don't know if it's real, but I saw it in the interwips. Okay, so it could be anything. Like I don't believe anything on the internet anymore.
No, why should you? It's full of, it's full of lies. It's a lie factory. It's a lie factory.
Yeah. No one actually says that having sex not for procreation is practically makes you gay. Is this some intertate shit? Yeah. Oh, thia. Yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, no th. Yeah, no th. No, no th. No, no th. No, no th. No th. No th. No th. No th. No th. No th. No one th. No one th. No one th. No one thi, no one th. No one th. No one th. No one th. No one th. No one th. No one th. No one th. No one th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No th. No, th. No, th. No th. No th. No th. No th. No one. No one. No one. th. th. th. th. th. thi. th. thi. thi. th. thi. thi. thi. thi. thi. thi. Tate shit? Yeah. Oh man, I don't
know. I like just have been... I can't believe it's real. It has to be fake. Someone has to have
hacked his account. Because I saw him, I saw a thing that I don't have X anymore, but I saw
on Reddit a screenshot of him saying like kissing a man kissing a woman is gay because
because she's sucked cock. So you're sucking cock? What?
Transitive property of cock?
Yeah.
If A sucks cock and B kisses A, then B sucks cock.
I mean.
Yeah.
I mean, at this point, like, nothing is, like,
we're just living in a simulation, right?
Nothing is real.
We've gone too far. Yeah, everything is fucked.
So on that note, Chris too. I love. th th th th to to to to to to to to to to to to to to to to to to to to to to to to to to to to th th th th th th th th th th tho. tho. tho. tho tho. tho. th th th th th th tho tho tho tho th tho tho tho th. th. th. th. th. th. th. th. th. th th th th th th th th th th th th th th th th th th th th th th th th th th th th thi thi thi thi thi thi thi to to to to to to to to to to to to to toooooooooooooooooooooooooo to to to to tho you like this movie. On that note, Chris too.
Chris too. I love Chris too. Yeah, who wouldn't? I wanted more Chris to. Things I wanted more of in my life.
Chris too. I feel like Chris too had more to give. Were you surprised when you found out that
everybody but David Desmautian in this movie is Australian? I figured it at the Dr. June was Australian
because she does the NAR at some point. She's the one who has the hardest time
holding on to her an American accent. You can see that her lips are like just
trying. They're just trying. The effort shows. But when I found out that
Carmichael Haig was Australian I was shooketh. That guy sucks. Yes, but he was convincingly American. Sure he was convincingly American.
I think because he sucks so bad and you're like, well, that has to be an American.
We're terrible.
We are awful.
So the movie starts off with some footage of the 70s being fucked up.
Yeah, it was a great time for murders.
I mean it was like peak murders.
And plays an excellent heavy metal song by the band Penagram over top of it.
Oh, no, tick it, tick, tick, no, no, tick, tick, tow.
It's nice, it's good song.
I like that from what you've described to me.
Yeah, you would probably dig Pettagram.
They've got a good groove. I can think I like to groove? Oh my God! There's three things I know about you,
grooming is too.
What's the third?
Oh, the third is a, I don't know,
farting, puking, uh,
uh, being a rat dude.
All of the above.
UBC's Night Owls.
Okay, go on. Night Owls. Did you realize who the narrator was in this movie? I did not. Michael Ironside.
Oh shit! Yeah. Good. Glad to see he's working.
So he explains to us that this movie is a found footage film
of the final episode of Night Owls. Yes.
And then we're gonna see some wild, crazy shit after we get through nine production companies.
Oh, I know. I like loved that Good Fiends claimation bit,
but like, who boy, that's a lot of production companies.
That's never a great sign.
Did no one believe it enough to give it all the money?
I feel like you guys could have gone three Z's on it, you know, nine?
It's a bummer.
Oh, man.
But also maybe we could get enough money to make a movie.
So we learned that Jack.
Jack Del Roy.
Heck of a name.
Heck of a name for a TV host in the 70s.
He's perfectly named and really perfectly cast, especially with that side part.
He is a TV host who's been trying to best Johnny Carson for years.
Seems like a fool's errand.
Just like why even bother?
I'd be happy to be number two to Johnny Carson.
Why wouldn't you?
I'm happy to be number, whatever 30 we are in the Apple podcast rankings.
I'm happy.
30's great.
Look at us.
Yeah, look and look what we did.
But we don't have that, that insatiable drive that a Jack-s.
But we don't have that insatiable drive that a Jack Delroy has. Yeah, I find that hard to relate to, that type of ambition.
Yeah, yeah.
Especially in the way it pans out in this one.
At no point are either of us going to join Bohemian Grove and become some sort of
satanic cultist to achieve our goals? I mean, if I were to do that,
it wouldn't be to make wear-wolf ambulance famous. I have other ends. How dare you? I just want to like
take a really long nap. That's what I need to sell my soul or something else for.
Deal Satan. I just need a good night to sleep. Why am I Southern in your...
Just say, I'll need a good-nots. You're Sighton.
Yana.
Prince of darkness.
But he's going to the Grove, but like, the real-life corollary is Bohemian Grove, if you've
ever heard of that.
I have not.
It's basically like a bunch of rich people get together in the woods and do like,
masonic rituals. get together in the woods and do like Masonic rituals,
but it's all just like so they can jerk each other off or whatever.
Oh, good for them.
Yeah, yeah.
You don't have to have a pretense to jerk each other off.
You can just have a jerk each other.
You can just have a jerk off.
Oh, I see.
So you get in there and you like, just have secrets with each other so you can you can like
try and help each other out. I see. And that's the whole thing with the owl on the
like the guy wearing the owl is from Bohemia and Grove. Oh really I thought it was because of night owls. Yeah. I told that but they're like their symbol is an owl. Interesting. I I I I I I I I I I I I th. I th. I th. I th. I they they they they they they they're they're the. I their. I. I they're. I they're. I they're. I they're. I they're. I they're. I they they they they're. I they're. they're. they they they they're. they they're. they they're. they're. their. their. their. their. they're. they're. they're. they're. they're. they're. they're. they're. they're. they're. they're. they're. they're. they're. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I they're. I they're. th. th. th. they're. they're. they're. they're. they're. they're. they're. they're. they're. they're. they they're. they're.that, but like that they're like their symbol is an owl.
Interesting. Yeah. I also thought because they said that the Grove is in the Redwoods of California
and he's got this like deep black side part and I was like, oh it's a Jim Jones reference. Oh,
interesting. It is not. No. No. But he does not, he does look not unlike a Jim Jonesian. He's very Jim Jones. He's. He's. He's. He's. He's. He's. He's. He's. He's. Yeah. Yeah. He's. Yeah. Yeah. He's. Yeah. Yeah. Yeah. Yeah. He's th. Yeah. Yeah. Yeah. Yeah. Yeah. He's th. Yeah. th. th. th. th. th. th. th. th. thi. thi. thi. thi. th. th. th. th. th. th. th. th. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. He's th. He's th. He's th. He's. He's. He's. He's. He's. He's. He's. He's. He's. He's. He's. He's. Yeah. Yeah. He's. Yeah. Yeah. He's th. Yeah. Yeah. Yeah. He's th. He's th. He's th. He's th. He's th. I. He's th. I's th. I's th. I's th. I's th. I's th. I's th. I th. I's th.ian. Yeah. Yeah, I could see him doing a movie
about Jim Jones. Yeah, I would watch that biopic. I'm fascinated by Jonestown. There is a movie
that it's like Ty West adjacent. Really? I don't know if he directed or has something to do with it.
That's basically a retelling of Jonestown as a horror movie. Oh, I mean, it's pretty horrific. Oh, it's absolutely awful.
Yeah.
Yeah, yeah.
Oh, we should find that.
Our boy, Ty West.
Our boy, our little boy.
I'm a booby.
You're just a boy.
You're so good.
We also learned that his wife has passed away from lung
cancer.
Never a smoker. Which they, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, thi, thi, thi, tho, tho, thi, thi, thi, tho, tho, tho, tho, tho, tho, oh, oh, oh, oh, oh, oh, oh, oh, oh, oh, yeah, yeah, yeah, yeah. Yeah, yeah. Yeah, yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. th. Yeah. th. Yeah. th. th. th. th. th. th. th. th. th. th. th. th. thi, thi. thi, thi. thi. thi, thi, thi, thi, thi. thi. to thi. to to to to to to to to to too. too. Yeah, together. Yeah, th. Yeah a smoker. Which they say like wink
but like a lot of non-smokers get lung cancer it's really a bummer yeah.
But they're like he went to this grove his wife died of long cancer is there
a correlation? I don't know watch the rest of the movie. He takes a month off. Yeah their takes a month off. Yeah, he takes a month off. Yeah, the to tak. tak. tak. takes takes takes takes takes to to to to to to to to to to to to to to to to to the to their their to to to to to to to to their to to to to to to to their to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to their their their their their their their their their their their their the the the the the the the the the the the the the the the the the the the too. toe. toe. to toe. to, but okay. Everyone's like, wow, he's taking time off. Well, yeah, his wife died,
you know. And I was also getting a little bit frustrated because at this point, you're
now, we're like 15 minutes into the movie and it's all being told in this format of the narrator,
showing us clips and like describing them to us. Yeah. I was like, I can't do this the whole time. What if it was the whole. I was the whole movie. I was the whole movie. I was the whole. I was the whole. I was the whole. I was the whole. I was the whole. I was the whole. I was the whole. I was the whole. I was the whole. I was the whole. I was th. I was th. I was th. I was th. I was th. I was like, I was like, I was like, I was like, I was like, I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was. I was th. I was th. I was th. I was th. I was the whole. I was the whole. I was the whole. I was the whole. I was the the the the the the th. I was like, th. I was like, like, like, like, I was like, like, I was like, I was like, I was like, I was like, I was like, I was like, I was like, I was the whole movie? I was worried that it was. And then after he's
come back he's not doing as well and he kind of takes this like, not Moripovitch.
Jerry Springer. Jerry Springer would be the relevant reference there of like
Clansman versus Blibbety Blow and like hiffy versus the cops and like all this stuff.
That just made me think of Deadliest Warrior, a show that you and I have both enjoyed
about they show the weapons of like ancient peoples and fight each other.
I would love that.
Hippie versus Boomer's.
Boomers, who probably were hippies?
Not anymore. Yeah, like at this point, he's had five good years and I thought well
that's pretty good you can just hang it up you can do something else but no
he can't. A tenel a genist or something. Yeah just retire. So this is Halloween
night 1977 the beginning of Sweeps Week. Right, they're gonna do their live show. And I was like do people in 2024 know what Sweeps Week was? God, probably
not. Yeah. Where everyone would watch one of three TV channels to decide that they were watching?
And whatever was going to be on was going to be like really over the top because it was
sweep's week. You had to get your ratings. Yeah. Even like later when they're talking about it's a 40 or maybe even a 50, I was like, I don't th. th. Even later later later later later later later later later later later later later later later later later later. even later later. even later later. Even later. Even later. Even later. Even later. Even later. Even later. Even. Even. Even. Even. Even. Even. Even. Even, even, even, even, even, even, even, even, even, even, even, even, even, even, even, even, even, even, even, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, the. the. the. the. the. the. the. the, the, the, the, the, the, the, the, the, the, the, the, the, the, the, the. the. the. the. the. the. the're talking about it's a 40 or maybe even a 50 I was like I don't know what that means that the percentage market share yeah yeah yeah and now
like television shows get like a three share and they're like fuck we're
doing good really is that just for show I mean I guess that only applies the
shows that are on like that air air air on television okay yeah yeah so if like survivor gets a three share they're the thr th so th so th I I I I I I I I I I th so th so th I th th th th th th I th th th th th th th th th th th th th the the th the the th th the they they're they're they're their the their they're they're they're they're their they're they're the the the the the the the the the the the the their their their their their yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah the the the the the the the the the the the the the the the the the the th the th th th thre thre threrere tho they. th. they. they. they. the the the they. the the they. the they. the the the the the th. Wow. Yeah. Because there's so much fucking TV. Yeah. I really
do remember when there were only a few channels. You could watch a couple of them. And if you like angled
the rabbit ears a certain way sometimes you could get a little bit of like whatever else was out there.
Do you remember clicking the dial on the television set? And now I'm just like I found this thing on thi thee. And now I'm just like the the the thi. Mm. Mm. Mm. Mm. Mm. Mm. Mm. Mm. Mm. Mm. Mm. Yeah, I'm just like I'm just like I'm just like I'm just like I'm just like I'm just like I'm just like the the the the the the the the the the the the their their their the their their their the the the the the the d' the d' the d' the d' the d' the d' the the the the the their their their their their their their their. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. I th. I th. I th. I th. I th. I th. th. th. th. th. they. they. they. they. they. the. the. the. the. the. the. the. the.. Here, it goes to my TV, now I live in the fucking future.
It's like the replicator on next generation of television.
I'm just like, give me a show about British cops and also swamp monsters.
And they're like, here, here there go. Yeah, why not? Why wouldn't that exist? It's called the Swamp Bay? It's great. It's the the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's the swamped. It's the swamped. It's the swamped. It's the swamped. It's the swamped. It's the swamped. It's the swamped. It's the swamped. It's the swamped. It's the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's the swamped. It's called the swamped. It's called the swamped. It's called the swamped. It's called the swamped the swamped the swamped the swamped the swamp bay the swamp bay. It's called the swamp bay. It's called the swamp bay. It's called the swamped. It's called the swamp bay. It's called the swamp bay. It's great. It's Jed Mercurio. It's dark and gritty.
It's called a Whistable Pearl Monster.
Enjoy yourself, go about your business.
I wonder if they started that new season
of Whistable Pearl.
I don't know.
I can't wait to watch it.
We'll watch.
Yeah.
We'll, we'll watch.
Maybe after we're done with a nice one, mate we can do a giant man baby and do a witsdable pearl. He's just a baby
with a beard I don't understand it. Like six foot five baby. Such a baby though.
No one knows what we're talking. No. Maybe people in the UK do I don't know. They're watching that
withstable pearl home. What's mitten perils market share? They just kept saying
whistable. I don't know what it means!
Oh, hang up your iPods.
So on the final day of the show, his guests are going to be Christo.
Love Chris too.
Carmichael Hague.
Yeah.
Lillie and Dr. June, and Miss Cleo.
Right, who we never see.
We never see.
And so it's Halloween night, so his Ed McMahon, Gus, his number two, his number two.
See, I know the Andy Rector. I didn't know that Ed McMahon was the number two.
He was Johnny Carson's number two.
If you gave me a picture of five old white men, I could not tell you which one was Johnny Carson.
There's a Johnny Carson.
Even if the other five were like my father,
other four.
Johnny Carson was a master of his craft.
I'm sure.
But there's also a Johnny Carson quote that I remember.
Was like, I want to pet my pussy and he said you'd have to move the cat first and I think that was the
funniest fucking thing I ever saw on TV and I may have made it up. I hope this
was a dream you had when you had a really high fever when you were maybe
11. It's right up there with I swear to Christ this happened but I know that there's no way that that that that that that that the the the the the the the the the the there's the the the the the the the the the the the the is the is the is th. th. th. It's th. It's th. It's th. It's th. It's thi. I's th. It's th. I's th. I's is is th. I was th. I was th. I was th. I was th. I was th. I was th. I was th. I was th. I was th. I was th. I's is is is is is is is is th. I's is is th. I's is th. I's is th. I's is th. I's th. I's th. I's th. I's th. I's th. I's th. I was th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I th. I th. I th. I was th. I way it happens. Regis and Kelly Lee, or no, Kathy Lee or Kelly?
Kelly, sorry, combined them all.
Regis and Kelly.
She was wearing a skirt and she crossed her legs
and he said, that's a big slit
and she responded, I've had three kids.
That's so fucking funny.
That's super fucking fun.
If that happened, it's very funny.
If it didn't, You're very funny. Yeah, exactly. Yikes.
I've had three kids as a fucking hilarious response to that.
I mean, that tells you a lot about a person and that tells me that I like them.
Yeah. Oh yeah, yeah.
If you're willing to go that hard in the fucking paint and you just be like, four people got this,
fuck the rest of you.
Very good. So that. So that that th th th th th th th th th th th th. So th th th th. So he th. So he th. So he th. So he scares. So he scares. So he scares. th. th. th. thus thus thus thus thus thus thi thi thi thi thi thi thi thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. to. to. to. to. to. thi. thi. thi. thi. thi. thi. thi. thi. th, fuck the rest of you. Very good. So he scares Gus by coming up behind him as a ghost.
And it's hilarious, and they have a great japed over it.
Gus still has the tag on his pitchfork,
his little plastic pitchfork, which I like quite a bit.
And he's playing the Tharman.
Yes, he is.
Which is the thing you can't touch to play it. Which which which which will will to to to to play to play to play the to play to play to play to play the to play to play to play to play the to play to play the to play to play to play to play the to play to play to play to play to play to play to play to the the the tooom. tooom. tooom. tooom. tooom. tooom. the the th. th. the th. th. the th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. the the the the the the the the th. the th. th. th. th. th. th. the. the. t. to. too. tou. toooooooooooooooooooooooooooooooooooo. tha. tha. thathing you can't touch to play it. Which will not come back at all.
Ever. Maybe we get some Jimmy Carter jokes, I don't know.
Well the monologue jokes, you get the nighttime monologue jokes. Okay.
It's like a big thing of the the talk show like thing. They do that every day?
Every day. Yeah. It seems like an awful gig.
Yeah.
Wow.
Yeah.
I don't watch like the Seth Myers or those things.
I don't even know who that is.
You don't know who Seth Myers.
No, I do.
He's from Pittsburgh, I think, or his dad was.
And he does like a yinzer accent as a joke a lot.
Yeah. And people are like, we th th th th th th th th th th th th th th th th th th th tho tho tho tho tho tho tho thu tho tho thu tho tho tho tho tho tho tho tho thi thi thi thi tho tho tho tho tho tho thi. I thi. Yeah, I thi. Yeah, I thi. Yeah, I th. Yeah, I th. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah, th. Yeah, th. Yeah, th. th. th. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. Yeah, I thi. Yeah, I thi. Yeah,, ah, he's exploiting you. When I do it, I'm not exploiting you because I don't get paid.
When I do it on the Gateway Clipper.
Did I do it on the Gateway Clipper?
I got a little tore up.
It was hilarious.
I mean, everybody is doing it.
Wait, didn't they ask if anybody knew what a Pittsburgh accent sounded like? It was something and you like,
you went after the woman in a hilarious way
in a very good.
It was very good.
Just sorry.
Just sorry.
You never apologize.
They're having this like, yeah,
he's doing the monologue.
They're having this fun interaction.
He's very good at the monologue.
Like, the whole like one hand in his pocket is very Johnny Carson. Okay. He's hitting all the beats he should be hitting.
He's obviously a man of my age you grew up watching this shit. Okay. Yeah, and he's talking about how
the occult is very big in the 70s now like in this time period. It's having a big revival. Right. And it was it really came back full force which led later to the satanic panic. Right. I mean one one be gets another. the the the the the the the the their. their. their. their. the the the the the the the the the the the the the beat. the beat. the beat. the beat. the beat. the beat. he. he. hea. hea. he. he. hea. It is hea. It's hea. It's heat. It's he. He's he. He's he. He's he. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He. He's. He's. He's. He's. He's. He's t. He's t. He's t. He's t. He's t. He's t. He's t. He's t. He's t. He's he's he's he's he. He's. He's later to the satanic panic. Right, I mean one be gets another, doesn't it?
Yeah. So on that note, they bring out Chris Stu, who is an occultist.
Hell of a chin on this man. Hell of a chin.
Eat your heart out, Bruce Campbell. Honestly, that is a chin for days.
And he's coming out and doing like this medium routine. What is his accent?
I believe he is...
No, now I can't remember if it's David Dashmolian or the actor who played Christo or Iranian. I know David Jashmolian is.
He's Australian.
Oh, he's Lebanese.
He's Lebanese.
He's Lebanese.
But I don't think, but they're employing him as Greek, that's all I want to say.
No, and he also says C to everything.
Yes, you're right, that's it.
Yeah.
I don't know what yes is in Greek.
I don't know why there.
Well, should we ask Google?
How do you say yes in Greek? So I don't know, I don't know what ethnicity he is playing at here.
Later when he has a freakout he loses the accent.
He does, yeah, he just is, yeah, that's true.
Okay.
So yeah, he's playing it up and he's doing like the, I'm getting a Pee, is it Peter or Peterson?
Or, and the guy stands up in the audience, like, Peterman?
Yeah.
And then there's this great back and forth
of the guy who's just fucking with him.
Barry, I love Barry.
Barry is great.
He talks about how his wife's maiden name was Peterman.
And he says, she ran off with my neighbor five years ago.
My golf game has never been better.
Barry. Barry should honestly get his own show because I find him funnier than Jack Delroy.
How dare you? He's pretty funny. He's pretty funny. And Jack Delroy is loving him taking the piss out of Christo.
Right. But then Christu like finds this mother and daughter.
Wait before that though, Jack Delroy is like poking fun at the skeleton costume sitting
next to him, like, oh, I see you got this at the same place as Gus's Cheapo costumes or whatever.
But the skeleton doesn't react.
And then is there at the end.
Who is that?
I don't know.
There's a theory that that is the devil. Because he doesn't clap either either, the devil, th. th. th. th. th. th. th. th. th. th. th. th. th. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. the, that's, that's, that's, that's, that's, th. th. thi, thi, thi, thi, thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. So, thi. So, thi. So, thi. So, thi. So, thi. So, thi. So, thi. So, thi. So, thi. So, theea. thea. thea. thea. thea. thea. thea.. The devil wouldn't, the devil's not a big joiner.
Right?
I don't know, I also feel like the devil's like down to have fun.
The devil's down to fuck around.
Yeah, he's down to clown, that's for sure.
Oh yeah.
Oh yeah.
Oh yeah. I mean, yeah. that the final card of the Molenko set was Jesus, but I don't know what you're
talking about. So like the whole thing with like the juggalos, like the Great
Melenco and all that stuff? Yeah, sure. Christ is the Great Melenco? Wait, really? I
believe so. And I don't know if they were fucking around when they came out and were like, yeah, we're born and again Christians. I don't know. But like, they they they they they they they they they they they they they they th. th. th. th. th. thi thi thi thi thi that that thi that that that that that that that that that that that that that's that's like, I the thi. Yeah, yeah, yeah, yeah, yeah, yeah, I that's that's that's that's that's that's that's like, I th. Yeah, I'm like, yeah, yeah, yeah, I the the the the the the the the the the the the the the the the their their their their their their their their their th. Yeah, th. Yeah, th. Yeah, thi, thi, thi. Yeah, thi. Yeah, thi. Yeah, thi thi. Yeah, thi thi. Yeah, thi thi. Yeah, thi thi. Yeah, thi thi. Yeah, thi. Yeah, thi. Yeah, 't know. But like they just dropped that later on. Okay.
It's kind of funny. That is kind of funny. Yeah, I bet Satan's pissed about that.
Or he's like, you know, I really did not want to be associated with you.
Despite how you've really come around in recent years. Yeah, everything I've heard about them is that they're actually
lovely men. Yeah, they've apologized for being shitty dudes back in the day. Yeah, most people they they they they they they they they they they they they they they were we we we were they were they were they were they were they were they were they were they were they were they were they were really they were really they were really they were really they were really they were really they were really they were really th. Yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, yeah, yeah, yeah. Yeah, yeah. Yeah, yeah. Yeah, yeah. Yeah, yeah. Yeah, yeah. Yeah, yeah. Yeah, yeah. Yeah, yeah. Yeah, yeah. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. Yeah, th. th. th. th. th. th. th. th. th. thi. thi. thi. thi. thi. thi. thi. Yeah, they've apologized for being shitty dudes back in the day. Most people don't do that.
Yeah, we were really homophobic and that sucks because everyone should be welcome to do whatever
they want.
I'm just like, chugge, oh!
Yeah, shaggy, too dope!
And the other one whose name is escaping me?
Silent and and daughter. Yeah, and he's like an Edward or in the mother's like Edmund?
Yeah.
And they learn that they've lost a son slash brother named Edmond.
He killed himself.
Yes.
No note.
And so he tells them that Edmonds and very happy and loves them very much.
And it says I'm getting a papa and the mother's like
that was his teddy bear papa. It's a weird name for a teddy bear. Well well he
loves it when you call on that. Yeah. He was big. And Christy was like well and the
mother's like I've kept all of his stuff and I just wanted to know that it's all safe
and he says I know and I was like oh that's fucking heartbreaking it sure
is hate people who manipulate people like this but it also seemed like I gave
that mom some comfort yes yeah yeah yeah because there is an Ed and Lorraine
Warren reference in this movie and I thought Alan hates them more than
anybody on the planet yeah I mean it's like Ronald Reagan Bill
Clinton and Lorraine Warren wow you're not even putting Donald Trump in that top I mean that's like he's like he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he he's like he's like he's like he's like he's like he's like he's like he's like he's like he's like he's like he's like like like like like like like like like like like like like like like he's like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's like. he's. he's. he's. he's. he's. he's. he's. th. th. th. I. I. I'm. I'm. I'm. I'm. I, you're not even putting Donald Trump in that top?
I mean, that's like, he's like the goat of hating,
so it's just like, why even bring it up?
Why even bring it up?
What about John Wilkes Booth?
This country would have been in much better shape,
if John Wilkes Booth hadn't shot Abraham Lincoln. If he had been able to oversee reconstruction, this is a lecture I got, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to, to to to to to to to, to, to, to, to, to, to, to, to, the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th., th. th. th. thi, thi, thi, too, too, too, too, too, too, too, too, too, too, too, too, too, the, thi, thi if he had been able to oversee reconstruction, this is a lecture I got last night.
It's true, Lincoln's politics weren't great.
He wasn't an abolitionist.
He was an abolitionist by happenstance, basically.
I feel like we can't get into this now or we're going to lose people.
And also, I'm going to say something wrong, and Rob will never know because he doesn't listen to my show, but if he did, he would be disappointed in me.
But the reason I don't put Trump at the top is because Reagan has been so much more time
with the shit that Reagan has done to fuck America.
Like he is, he fucked America profoundly, as did Bill Clinton.
Equal Opportunity Hater.
That's fine.
But yeah, and Lorraine Roarne.
Go fucking fucking-
Number three.
Tied, tied for worse.
And I do like that when they're referenced, it's shit-talking.
It is a bit shit-talky, isn't it?
I do like that.
But so Kristo,
Christu suddenly reacts like he's like saying, Minnie, a non-married man with a wedding ring. Everyone's like, who could it be?
I think this is actually fairly obvious.
Okay, go on.
He's like, so much sadness.
Yeah.
And then he goes and sits down after the lights flicker.
Yes.
And he goes and sits down and then he bring out Chris or Carmichael. Well, first they throw it to commercial and I thought, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, tho, and I tho, tho, and I tho, tho, tho, and I tho, and I'd tho, and I'd, and I'd tho, and he's, and he's, and he's, tho, tho, tho, tho, and he's, and he's, and he's, tho, tho, tho, tho, thi, thi, thi, thi, thi, thi, thi, thi, thi, and he, and he, and he, tho, tho, tho, tho, tho, tho, tho, tho, tho. tho. thoooooooooooooooooooooooooooooooooooooooooooooooooooo. And, th. And, Well first they throw it to commercial and I thought my god I wish I could throw it to commercial whenever I feel
awkward just like in a moment where I'm talking to someone and I'm like
oh sorry we're gonna go talk about borax for a little while I'll be right
back. Just a quick word from our sponsors and I will be out of here. Oh God just walk away smoke a cigarette and come back. to the tho to to smoke. to smoke. to smoke. to smoke. th. th. th. th. th. th. th. th. th. th. th. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. the thi. tho. tho. I'm tho. I'm tho. I'm th. I'm th. I'm th. I'm th. I'm the the the the the the their their their their their their their th. I I I I I I I I I I I I I I I I I I I'm th. I I'm th. I'm th. I'm th. I'm th. I'm th. I'm thi. I'm thi. I'm thi. thi. thi. thi. thi. to to thi. to. to. to. to. to. tha. tho. I'm thi. I'm a new mind about it, you know. Go talk to the coped-up producer backstage. I do miss that thing about smoking and I was like, you know what,
I'm gonna just gonna step out for a minute? Step outside for three to five minutes. I'm having a cigarette.
Yeah. I'll come back and we'll finish this conversation. Totally. And you'll have to deal with my terrible, terrible, they're their their their their their their their th. So tho' that. that. that. that. that. thra. thra. thra. thro' thro' thi. thi. thi. thi. I'm thi. I'm thi. thi. I'm thi. I'm smoking smoking smoking smoking. I'm smoking smoking smoking smoking. I'm smoking. I'm thi. I'm smoking smoking. I'm thi. I'm th. I'm th. I' smoke. I's th. I's th. I's th. I's th. I's th. th. th. th. th. th. th. thi. I's. I's. I's. I's. I's. I's. I's thi. I's thi. I'm thi. S. S. I'm the. S. S. S. I'm smoking. S. I'm smoking. I'm to smoke. S. I'm to smoke. I'm to smoke. S. I'm throooooooo. S. I in the movie, he's like, don't worry about Hague.
He's all wax no wick.
That's such a good phrase.
I love that.
Yeah.
He also says something about bats in the cave,
and I don't know what that means.
Who knows?
Okay.
Yeah.
So we learned that he brings out Carmichael when they come back to air.
And the the the the the the the the the the the th and th Carmichael when they come back to air. And they cut over to Christo and he looks like shit. He's not doing well. He's sick. He's a
very sick man, yeah. And Carmichael is a former magician who is now a skeptic,
very, what was it, the Amazing Randy? I don't know what that means? He was a
the Amazing Randy was a dude who was like, was a form magician and it was like, you know what? this? this? this? this? this? this? this? this? th this? He this? He th this is? He th th th th th th th th th th th th th th th thi? He's thi? He's he's he's he's he's he's he's all, he's he's he's he's he's he's heat. He's he's he's he's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he. He's he's th. He's th. He's th. He's thi. He's th. th. thi. thi. thi. He's he's he's he's he's he's he's he's he. He's he. He're really teaching me a lot today. The Amazing Randy was a dude who was a foreign magician and was like, you know what,
this is all fucked up because there's too much like bullshit going on.
So I'm going to expose fraud.
I'm sorry, how do you become disillusion with being a magician?
I think it's because you realize that people are cheating people and Lorraine thee. I see, we're not not th th th th th th th th th th th th thing thing thing thing thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi. thi. thi. thi. thi, thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. th. th. th. th. th. th. th. th. th. th. th. th. th. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thiii. thiiiiiiiiiiiiiiiiiiiiiiiiiiii. thii. thi. thi. thi. tricks to cheat people. I see we're not talking about like, hey look at this card.
Yeah, they're not going on to like David Blaine. Gotcha.
But they're going after people like mediums. Gotcha. Okay.
Fair. They're saying I'm talking to your and they're actually not talking to your son.
No, they're just bullshitting. They've gotten people to people to interview toitating that information to make you feel bad. Cool or good either way. He's doing magic tricks with a cigar which I
hate to which I just wrote ug. But I liked when he lights the cigar with just
his hand in front of his face and well I liked it because Jack Del Roy is going
I'm sitting here I don't know how he's doing it. In the most like over the top obviously I know what he's doing but I'm going to to to to to to to to to to to to to to to to to to to to to to to to to to to to the the to the to the the the the the the the the the the the the the the their the their their their their their their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. I'm their. I'm their. I'm their. I'm te. te. te. te. try. te. te. try. te. te. try. te. te. try. try. I. I. I. I. I'm's doing it. In the most like over the top, obviously I know what he's doing, but I'm going to sell it like he's not.
Ah.
It felt very much like wrestling.
I'm like, I'm just selling this for this guy.
Yeah, slapping yourself.
Yeah.
He pulls out of check and I was like, everybody right on those rooting and account numbers.
Because he is offering money to anyone who can prove the the real paranormal stuff? Yeah, okay, yeah.
Yeah, so he's offering a hundred thousand dollars.
Which is a lot of money.
In 1977, I can't even imagine.
Yeah, I'm not even going to look it up.
No, I'm my parents in 1974 bought the house I grew up for $19,000.
Wow. How about that? Yeah.
Yeah. Christu is doing this like, it looks like a catatatatatatatatatatatatatatatatatatatatatatatatatatatatatatat th. like a th. th. th. th. th. th. th. th. th. th. th. th. to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to the the the the the the the the the the the the the the the the the th. Yeah. Yeah. thi. the. the an theanan. theanan theanan, theanan, theanan, theananananan, theatuu. Yeah. Yeah. Yeah, toeanor. Yeah. Yeah, to. Yeah. Yeah. Christo is doing this like, it looks like a cat about to throw up.
He's just like, uh, like moving his shoulders.
It's even like, uh, no.
But also being offended about the stuff that Carmichael is saying to him.
Yeah, like, I'm a skeptic, obviously, in my life, but I'm on team Chris to here.
Like, the. Yeah, exactly. Yeah, I don't know why I don't mind like a carnival act that's like doing that stuff
But then like when you're Ed Lorraine Warren doing that stuff it really bums me out. Well, they're doing it in the name of the Lord
They're doing in the name of the Lord and they're doing it in the the name of the Lord and the the the the the the the the the the the the the the the the the the the Lord the Lord and bullshit the Lord and bullshit the the the Lord and the the Lord and bullshit the the the the the the they're doing they're doing they're doing they're doing they're doing they're doing the their they're doing in bullshit. they're doing it's they'reserving by looking like selfless, yeah. And we've never accepted any money for this
except for all the speaking engagements that we do. Books, the books. And the books.
And the TV and yeah. Well I don't know if Chris Dew's written any books but he's not going to now.
He will never get a chance to. Because he pukes black bile all over the stage and all over
Carmichael specifically. It's very good. It's very good. It's very fun. So which Carmichael later calls
controlled regurgitation of O'dville bit and I was like, oh that's what you call it? I call it puke on command.
Sorry guys, I have to go controlled regurgitate me right back. B.R.B.
So they throw it a commercial then.
And also, Christy was throwed water in Carmichael's face
before he vomits on him.
Which is nice. That's a nice touch.
Yeah. Always throw a drink in someone's face.
I have never thrown a drink in anyone's face and I regret it immensely.
Have you ever had a drink thrown in your face?
Yes, at a party that I then got kicked out of for getting into a fist fight because somebody
throw a drink in my face.
Wow.
You want to know what I did to deserve that?
I can't wait.
I was playing beer pong.
And I was counting the count from Sesame Street. One, two, two beer bung balls. Ah, ah, ah.
And my friend and I were laughing, and this girl was like, what are you laughing at?
And we were like, two beer bungal, ah, ah, ah, and she just threw, she was like, do you know
who I am? We're like, no. And she threw a drink on us. That was Wendy Bell. And bitch up at IUP. What were you doing at IUP?
Party in!
Not being allowed back.
I like how that changed it for you somehow.
You were on enemy turf.
All right.
Did you find it interesting that this like sort of flailing late night host was in with the rich
and powerful of the rich and powerful cult?
No, no, they would definitely be.
Really?
Yeah, for sure.
Because at this period of time, like, they would have the rich and powerful on their
TV shows.
I see.
Yeah, oh right.
I guess they do like celebrity interviews and stuff. Sure, sure, thia, thia, thia, thia, thia, thia, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, tho, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, tho, tho, th, th, th, th, th, th, th, th, th, th, th. th. th. th. th. th. th. thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi. thi. thi. thi. thii. thi. thi. thi. thi. thi. celebrity interviews and stuff. Sure. Yeah. I mean, that's how Donald Trump became Donald Trump. Like being...
Who? Who? Oh, the America's greatest president. Can't even say it without laughing. No.
When he started to say it, I like clenched every bit of my stomach. No. Good Lord. Yeah.
Imagine being a dip shit in thinking that.
I mean, if you feel the same way the people saying Joe Biden is her greatest president,
it was like, is he?
Well, who is that now?
And pick one?
Abraham Lincoln.
I know it's going to be like one of the Ferd B. Hayes, James A. Garfield, Chester,
Arthur, Gronin.
Andrew Johnson, he goes, fucking suck a bag of egg.
He really botched, he really botched reconstruction.
He really botched reconstruction.
Yes, he did.
Yeah.
Yeah.
Yeah.
But, I th Reconstraunchion. He gave to the Southern Convention.
Yes, he did.
Yes, he did.
Yes.
We are really all over the place in this episode.
Kids love it.
They love getting a history lesson.
Yeah.
I'm looking about Johnny Carson and Andrew Johnson.
Why bother listening to the plagiarism of the dollop?
the dollop? The dollop is like a pretty famous comedy history podcast and they were plagiarizing and then got real
defensive about it. So we are we learned that Dr. June Rosemill, June Ross Miller,
June, Dianne Raffiel. See now her I like. Yeah, who doesn't? Yeah, she's fucking great.
She's fucking great. Wrote a book called Conversations with the Devil.
Yes.
Which is about her having adopted a child from a blood sacrifice called.
Yes.
The first church of Abraxas.
That's got to be like a conflict of interest, right?
Not in the 70s, I think.
I think in the 70s you could just have any child you wanted.
What's the famous Satanic Panic book that like started at all that's like a young girl?
Michelle remembers?
Yes, that's what I think this book is supposed to be referencing.
Oh, gotcha.
Yeah.
Yes, so this is Lily the child, sort of like background with clips of the cult doing cult things which felt
very hell-house to me where it's like no one filmed that you know no one filmed
them rubbing their blood all over their hands. And I also, their cult
headquarters was just in this like suburban house on a fairly densely
packed street and I just really like the idea of people going in and out of that house wearing the red robes like you know Mrs. Flanagan's
across the street watering her flowers and there's just like red robed figures
going in and out. I thought that was very funny. Well I thought that was
supposed to reference Anton Leve's Church of Satan which was like just in
San Francisco. Okay. that was just like a black Victorian house in San Francisco that was just like in a neighborhood. Okay. Yeah, so I think that's what this is supposed to do.
Like still very funny.
But it was also because it's like a ranch house.
It's not even like a cool house.
No, it's just a regular little bungalow.
Yeah.
Oh, bugglow. Yeah.
Next door to the Morgans.
So yeah, Lily flips her shit sometimes, I guess, because she's got the devil in her. When she comes out, the audience goes,
aw, but she's like 13 going on 17.
It was a weird, it was a weird awe.
She's not a puppy.
And dressed in like, like a little child.
Yeah, she's wearing a denim jumper.
Yeah, it's got like baby Jane vibes.
Yeah, I love that movie.
So she comes out and she's down the barrel of the camera the whole time.
I thought that was sort of funny and then I thought,
I'm not sure it's supposed to be, I think it's supposed to be scary.
So, this movie is listed as a horror comedy movie.
Okay.
And it was like, I get, I mean, I would say no. No, We will see a woman dying of cancer later.
I mean, right at the top, frankly, yeah.
It's, yeah, maybe I was just made uncomfortable and so I laughed.
Sure. But I also always think people looking directly into camera is very funny.
Yeah, yeah.
And Jack tells her that she doesn't have to look down the camera, she can just interact with the people. Right. And we understand from Dr. June the the the the the the the the Dr, the the the the the th th, th, th, th, th, th, th, th, th, thine, thine, thine, thine, thine, I, I, I thi, I thi, I thi, I thi, I thi, I mean, I mean, I'm th. I'm, I'm, I'm, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, right, th. I th. I th. I th. I th. I th. I th. I th. th. that she doesn't have to look down the camera. She can just interact with the people. Right. And we understand from Dr. June Rose, Ross Miller,
June Ross Miller, that Lily is becoming too unpredictable and she doesn't think that they should go through with what they were planning tonight. Yes. Yeah, but he's getting real handsy with her. Yeah, they seem to have a little thing that going on. they fucked. Because Lily is like, while they're on camera, she's like, Dr. Jun Dian
Raphael thinks you're very attractive. That's right. And she also says, don't
worry, you're going to be very famous soon. That's right. I think you're going to be very
famous soon. They cut to commercial and we learned that Christu died on the the hu fucking th fu fu fu fu fu fu fu fu fu fu fu fu fu fu fu fu fu s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s s, th, th, th, th, th, th, th, th, th, th. That's th. th. th. th. thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi. thi. thi. thi. thi. thi. thi. thi. thiiiiiiiiiiiiiiii. thiiii. thi. thi. thi. thi. thi. commercial and we learned that Christo died on the way to the hospital.
Yeah, fucking hemorrhage out of every hole. That sucks for Christu. Yeah. Why does that happen?
The devil. Got it. Or something. They just say he was spouting from everywhere. That's awful.
Awful. Awful, funny. I mean mean I think it's awful funny. Yeah. Why are the backstage scenes in black and white?
Uh, I guess saying they were filmed on like a cheaper film stock maybe?
Okay. Yeah. I found it a little disconcerting. Did you? I did? Yeah. And I think it's supposed to differentiate for the viewer that this is not what aired. Well, yeah. I'm not a fucking idiot. Did you? th? th you? th you? th you? th, I? th? th? th? th? th th the th the th they? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? Why? the? Why? the? the? the? Why? Why? I? I? the? I? the? the? the? the? the? the? the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the back? the back? the back? the back? the differentiate for the viewer that this is not what aired. Well, yeah.
I'm not a fucking idiot.
So we get Phil who is like the guy who's controlling everything back behind the scenes.
And he's saying to someone in the control booth, I don't know what you're seeing,
but we're not seeing it down here.
Oh, I missed that.
And they never like illuminate what that is. Okay. But in the booth they're seeing something that they're not seeing down there. Interesting. Yeah, the devil. Probably the devil. Probably. A devil. Maybe not the devil, but at devil. Sure. Yeah, a Braxis. Yeah, a Braxis. Yeah, a praxis. Talk about praxis. I love when you do a sports.
You just know him because he's got your same name.
Hey I.
Like once a week to Missy else, she'll judge me about something and I'm saying,
are you God and or Alan Iverson, judge me?
Alan Iverson gets to judge?
He has a tattoo that says only God can judge me? So I figure it's like God, Alan Iverson, everyone else. Yeah, he's the
number two. Yeah. Yeah. How does she like it when you say that to her once a
week? It's in the litany of things that get on her nerves. I'm a joy. I'm a joy. You are. You are. An absolute joy. During the same the same the same the same the same the same the same the same the same the same the same the same the same the same the same the same the same the same the same an absolute joy. During the same commercial break, Carmichael goes
to the mother and daughter who lost Edmund. And they're like, so, he's like, oh, did anyone
talk to you before the show? And they're like, yeah, there was a nice woman who asked
this bunch of questions out in the hallway. I like the idea that they were too stupid to put that together without his interference, this this, this, this, thi, thi, tho, thi, thi, thi, thi, the, the, the, the, the, the, the, the, the, and the, and I toe, toe, I toe, I'm too, I toe, I'm toe, I'm toe, I'm toe, and I too, and I too, and I too, and I too, and I toe, and toe, and toe, and toe, and toe, and toe, and toe, and toe, I toe, I toe, I toe, I the, I the, I the, I the, I the, I the, I the, I'm the, I'm the, I'm thean thean thean thean toeaniiiii. toean, toean, toe. toean. toe. toean. toe, thi. the that they were too stupid to put that together without his interference, this fucking awful, obnoxious skeptic.
They seemingly don't even put it together after he gets out there.
That's true.
He asks some of these questions and they're like, that was interesting as well.
I love me asking some more.
No one never asked me questions.
So Dr. June and Lily are setting up to do their thing and Carmichael is like grilling
Dr. June.
He's being a real piece of shit.
Let her answer the questions she's asked.
And basically like being kind of a misogynish and just talking over a woman because
she's a woman.
And she's like, I literally have a PhD in this and he's like, yeah, but from where?
She's like, yeah, but from where? And she's like, Stanford.
Can you get a PhD in parapsychology?
I don't think so, Dr. June.
She says something about minor deities that serve Abraxas as well, and I was like, you're
losing me, Dr. June.
A Braxus just sounds like a medication, not like a demon.
Yeah, I mean, it is a thing. It's a, I don't know that it's a deity.
I think it's just a word that means like-
I thought it was like some sort of weird demon.
Okay.
But like, like, a sort of like,
inconsequential demon.
Okay.
I thought I looked it up.
Oh, the Persian sun god. Yeah. But it's also got like don't take a Braxis if you're allergic to
Braxis will cause diarrhea. Yes. Oh a Braxus here's a picture of him, a photo of
him. He's adorable. Why is his tail tied in several knots? I don't know.
Why do you see snakes for feet? Yeah because that's what a Braxas does. I'm looking, I'm more interested in Abra He's from the infernal, this picture is from the Infernal Dictionary from 1863.
Yeah, it must be real. That's during the Civil War.
We started watching Man Hunt about John Wilkes Booth. It's a problem.
Oh, I think Pat and Oswald is in that. Is he? I haven't seen him yet, I'll let you know. Ambraxus.
He made a show about hunting down John Wilkes' booth.
Yeah, it's pretty, it's actually pretty good so far.
Okay.
Well, let me know when you get to Patton Oswell.
I sure will.
And so they, she's brought out a half skull, like a skull cereal bowl,
and a sacrificial dagger, and then some candles, and the sacrificial dagger was taken
from the adobo or whatever the death cult's name was.
Sure.
And that was like the one thing that didn't burn
when they burned everything, Waco style in the house.
Oh right, they said it on fire.
Yeah, yeah, the cult has like a little bit of Jonestown, a little bit of Satan.
They sure do.
And Lily tells us about the demon that lives inside her.
M.R.R.Riggles.
June says that everyone has a demon inside them.
And I don't know.
I don't know how I feel about that.
Well, her and Anthony Keaton just thinks that. No, it's just in his semen. It's not, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's, it's not, it's not, it's not, it's not, it's not, it's the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the, it's, it's, it's, it's, it's, it's, it's, it's the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the touche.cha, too, too, too, tea.s, tean, tean, tean, tean, tean, the tha.s, the the don't know how I feel about that idea. Well, her and Anthony Key just think that. No, it's just in his semen. It's not, it's not, it's not good.
And then the theramin starts playing loudly. Yeah. And nobody's over there playing it.
Theramining. Theramining. And when Gus tries to touch it or get near it, it shocks him. And then the glasses start breaking. And then Carmichael just goes over and unplugs it. And he's like, uh, it was feedbacking. You guys are idiots. You're literal morons.
Right into your PA. And Lily says, it was Mr. Riggles. He did it. Mr. Riggles. Mr. Riggles.
Riggles. And it very much feels like the not me and family circus at this point. The what now? Did you never read the family circus cartoon? the th. And th. And the th. And th. It th. It is. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's. It's, the the the the the the the th. It's. It's. It's, it was the the the th. It was the th. It was the th. It was the th. It was the th. It was th. It was th. It was th. It was th. It was th. It was was th. It was th. It was th. It was th. It was th. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was the the the th. It was the th. It was the th. the th. the th. the the th. the the. the the th. read the family circus. The not me was the thing that did all the bad things in the family
circus house and they're like, who did it? And they're like, not me? Oh, family circus. It wasn't
good. It wasn't funny. It was no Ziggy. Ah, Ziggy. I can't with that shit. Too sad. Just a single lonely man th. th. th. th. th. th. th. th. Oh. Oh, th. Oh, th. Oh, th. Oh, th. Oh, th. Oh, th. Oh, th. Oh, th. Oh, th. Oh, thi. Oh, thi, thi, thi, the the the the the the the thi, the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th. Oh, th. Oh, th. Oh, th. Oh, th. Oh, th. Oh, th. Oh, thi, thi, thi, thi, thi. Oh, thi. thi. thi. thi. thi. thi thi thi thi thi thi thi thi thi thi thi. the the returns department and not getting to return whatever
he's brought in. Wow, love this for him. I've told you about the Christmas special that's
super fucked me up because it's all about homelessness. I'm four! Could Ziggy and Kathy never just
get together? I don't know if they would be perfect for each other or if
they would just both die within days. There's like a co-dependency thing that
could happen. Yeah I feel like it could get really ugly between Kathy and Ziggy.
This is painting suit made me look chocolate. Ack!
Oh man you guys remember a cartoons in the, or comic strips in the newspaper?
I think they're still there.
So they're going to restrain Lily, put her in a chair and put restraints on her.
Yeah, they're inviting Mr. Riggles to be on the show, which I think is a bad idea.
But Lily really wants to.
Yeah. She seems to want it for all to your ear motives. I mean, she's telling Dr. June. that that that that that that that that that that that that that that that that that that that that that that that that that that that to. Yeah. And she seems to want it for all to your ear motives.
I mean, she's telling Dr. June that they need to prove to the world that it's real.
Sure.
And Dr. June is like in tears because she definitely fucked Jack Leroy, Delroy, Jack Delroy,
and he like totally sells her out right here.
Yeah, because he like totally sells her out right here. Yeah, yeah, because he sucks.
He's, yeah, he's not a good dude.
Like no one's under the illusions that he's a good person.
Uh-huh.
So I will say at this point, like,
the lighting and the set design on this are fucking perfect.
Yeah, it's great. They are exactly what, like, they feel like you're watching a show of the the the th. the th. th. th. th. th. th. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. thi. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. I. thi. I. the. I. the. I the. I's. I the. toe. toe. toe. toe. toe. toe. toe. toe. toe. toe. toe. the. the. the. the. th show of the era. Yeah. And also I'll get into it real quick.
This movie used some AI art.
Like there's three pieces of AI art in the movie
with the interstitial pieces when they cut to commercial.
Oh really?
And people are upset about this because graphic designers were not employed.
They used AI art rather than graphic designers.
And while like, I think on a service level,
like, I'm like, yeah, they did that.
Yeah.
But it's also like that's the tip of the spear going in.
That's going to wedge out graphic designers
from being in film anymore.
Yeah. So I understand people being upset about and boycotting this film because of it. That's the firstthe first I've heard of it. Yeah. Yeah, yeah that sucks. But I will say
the like the people that they did having did have doing the set design did a
fantastic job. Yeah for sure. So they get lit by the spotlight and Jack comes up
and he's very close to the camera when he does. And it's just very good the way it's done, I thought.
And at this point, too, we've also learned that Gus and several other crew members are
like terrified.
Not down to clown.
They, it's strange that they're all convinced and not just thinking that like something
terribly medical happened to Christo.
It's strange that they're all sure that something bad is happening. Right, because they try to keep under wraps that he has passed away.
Yeah. But like it's sort of spread through like wildfire, as it would.
But it's like to jump to like something supernatural instead of being like, my God, it's so sad that man just died.
Yeah. Yeah. And you're manipulating this child on television. Yeah. There's like like thiii manipulating thii manipulating thii thi thi thi thi thi thi th thi th thi thi th thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi thi that's sort sort sort sort sort sort sort sort sort sort sort sort sort sort sort that's so that's so that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's that's sort thi thi thi thi thi thi thi to thi to to to to to to thi to to to to to to to thi to to to thi thi thi thi thi thi thi th all this like, yes, there are legit things to be upset about in this situation.
Like Lily always looking directly into camera, which she's still doing in this scene.
So she, Dr. June puts Lily under.
And then the exorcist shit happens.
Makes her hair greasy.
Yeah, very well, why does her hair get so dirty?
I don't know. Why do her eyebrows get so pink? I actually kind of like that look.
Yeah, it was a good look.
Also, the jaundist eyeball was a good look.
Yeah, she looks, I mean, I think the makeup effects are really good.
Yeah, they like, like made her have like a protruding brow ridge and stuff.
Yeah, like a person from Ohio.
Wow. The sentiments of Katie do not represent all wearable than ambulance.
I happen to think Cleveland rocks.
I said what I said.
But she comes under, and this is one thing that I did not like, I did not like the voice modulation on her.
You didn't. I didn't, because you can hear her voice
underneath the modulation.
I actually liked that.
Did you?
Yeah, what did you, you felt it was too like?
I wanted just like a voice.
I wanted the exorcist voice.
Gotcha.
Just had that voice to come in and do the little boy they like couldn't match up the bad the demon voice with his lips. Oh that was the Pope's exorcist. Yes it was.
Oh yes it was. I cannot wait for the next one. So many of these movies. Oh I'm so happy.
Can't wait to do them with Eli and Heath. Yes and not Noah because he doesn't want to be around us. Three times a choice. So while she's under, Lily says he's here. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. he's. Yes. Yes. Yes. Yes. Yes. Yes. th. Yes. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. Yes. Yes. Yes. th. th. th. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes choice. Three times a choice. So while she's under,
Lily says he's here, isn't he? Good to see you again, Jack. And everyone's like,
oh, and Jack says, I don't believe we've met before. We met amongst the tall trees. We know that he's been in the redwood. The redwood. The red trees. You ever seen the redwood. I have not. I got to see a red wood. the. t. t. t. t. t. the. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. the. the. the. the. the. thea. thea. thea. thea. thea. thea. thea. thea. tree. tree. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. t. te. te. te. te. te. te. te. te. te. te. te. te. te. t. t. t. t.'re a tall trees very tall trees you ever seen the redwood yeah I have not I gotta get I got to see a redwood it's very fucking cool
I bet yeah there's like seeing dinosaurs yeah yeah wow yeah yeah old shit I know
people just cut him down what are we doing here yeah fucking it up
and so the devil within lily yeah a braxas or whom at thus or one of his friends, is doing this like
little monologue about you know what happened to his last whore, which is his wife.
Yeah. And then start singing Jack and June went up the hill to fuck each other's
brains out. That's pretty funny. And then the second time they get to bleep it. Yeah, I liked that actually. I thought that was a nice touch. And then she says how could could to to to to to to the to the the to the to the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the their their their their their their their their their their their their their their their their their their their their their their their their their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the second time they get to bleep it. Mmm, yeah. Yeah, I liked that actually. I thought that was a nice touch.
And then she says, how could you let it happen, Jack?
Yeah.
But it seems to me that he didn't let anything happen.
It seems to me that he put things in motion.
Yes. Yeah. Yeah. And June smacks the shit out of Lily to get her out of this thing and stop saying so that she's been bumping and grinding with Jack.
Well, that's her kid and you're allowed to slap your own kid in the face.
Oh yeah.
Oh yeah, 17's coming.
Oh my god, this is encouraged.
Encouraged.
Just slap your own child.
If you're in spare the skeptic, like you can be a skeptic without being condescending.
And right now he's ruining everyone's vibe. Everyone had a super spooky time.
But from his perspective, a child is being abused in this situation. So I understand him being matched. She levitated. She thought it. She levitated. Yes, but she's th. th. th. th. th. th. th. th. th. th. th. th. th th th th th th th th th th th th th th th th th th thi thi thi thi thi thi thi the the the the the thi. the the the the the s the skeptic. Like the skeptic. Like the skeptic. Like the skeptic the skeptic the skeptic. Like the skeptic. Like the skepted. Like the skepted. Like the skept. Like the s the s the s the s the s the s the s the s th. th. th. th. th. th. th. th. th. thi thi. thi. thi. thi. thi. thi. thi thi thi thi thi thi thi thi thi. thi thi. thi. thi. thi. thi. thi. thi. thi.. I thought you were going to say she loved it. She loved it. She loved it. She levitated. Yes, but she's also been smacked in the face. Oh sure, no, it's not
great. I don't think he cares that she got smacked in the face. I think he cares that she's being used in a con. Sure. If he had children, he would smack them in the face. He's that kind of that. If that kind that kind that kind that kind kind kind that th. If th. If th. If th. If th. If th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. the. Yes, the. Yes, the. Yes, th. Yes, th. Yes, th. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. Yes. th. th. th. th. th. th. th. th. th. the th. th. the th. th. the th. th. th. the th. the th. the th. the the th. the the th. th. the the th. the th. th. th. the. the thethen they cut to messages, they cut to commercial.
The band is still playing. Gus has told us that three crew members have quit. And I looked at the band.
I was like, you know, you guys aren't going to quit, are you? Yeah. They're in there. The oboe player ain't leaving. No. Jack is like, thrown. thrown. Jack is like, thi. Jack. J. J. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thus. thus. thi. thus. thus thu. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. was like this is great. I want to make you guys a regular spot. And June's like, you know, that's fucked up. I do not want to do that with my child.
She's right. Yeah. No, no, no, she's a hundred percent right. Yeah. I also like when they
come back we had, there's a shot of them, a sort of a wide shot of all of them sitting in chairs and you see the boom microom, the the the mice, the mice, the the micrown, the th, the th, th, th, th, th, th, th, th, th, th, th, th, thrown, thrown, thrown, thrown, thrown, thrown, thi, thrown, thrown, thr-like, thr-s, she's thi, she's thi, she's thi, she's thi, she's th. She, she's th. She, she, she, th, th, th, th, she, th, th, th, th, th, she, th, th. th. th. th. th. She, th. She's the, thin, the, thin, thin, thin, thin, thin, thin, thin, thin, th's thin, thin, th's thin, thin, thin, she's thin, she's thin, she's thin, she's th's was a really nice little touch. And, but before that, they have to get her out of the constraints.
Oh, right.
The constraints aren't opening and the only way they can get her out is to cut her out with a ritual dagger.
Which matters?
I think that unleashes the demon.
Oh, I think that releases the demon from its bonds. Okay, all right. Okay. That's the only thing. I I I I I I I I that. that. that. that. that. that's that. that's that's that's that's that's that. that. that's that's that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th. th. th. th. th. th. th. th. tha. threat. threat. threat. threat. the. thea. threat. thea.a.a.a.a. thea.a.a.a. thea. thea. thea. thea. tha. the. And that's the only thing I could, because the ritual tanker, like, it comes back up later
on the movie, but I think that's the thing that is the catalyst to all this shit going off.
Okay.
That's my theory.
Okay, I like it.
Thank you. I felt like this movie built and built and built and the end was a bit, the end was th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, that, thi, the, that, that, thi, but thi, but that's that's that's that's that's that's that's that's that, but, but, but, but, but, but, but, but, but, but, but, but, but, that, that, that, that, that, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi. thi, thi, thi. But I thi, that's thi, that's that's thi, but thi, th Okay. But anything you can give me like that, that might help. Don't worry, I got more of it.
Yeah.
So Carmichael is like, all right, I know what you did.
And we've learned earlier that he's a master of groupist hypnosis.
Yeah.
And I started thinking about how we were going to get you hypnotized.
I'm still up for it. Any time you want to do it.
I forget there was a tha tha tha tha tha tha tha tha tha thi thi thi thi th get you hypnotized. I'm still up for it. Anytime you want to do it. I forgot there was a trade-off. I had to do something stupid if you were going to do that and I don't remember.
I think it was such a horse and you've already done that. Oh really? I should probably get
hypnotized and get the were a phambulist tattoo. I mean you have made promises that you have not the 50. Yeah. Yeah. Yeah. Yeah. It. It. It hurts. It hurts. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. It's the th. H. I's th. I's th. I th. I th. I th. I th. I th. I th. I'm th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I th. I the. I should should should the. I the. I should tho. I should tho. I should th. I th. I th. I thtoo artists that would have do the werel fabulous tattoo on me, get in touch. Yeah.
I'll pay you.
It's enough for free.
Yeah.
Also, are you also a hypnotist?
Can we get a two-fir?
Whenever I hear hypnotist, I just think of the They Might Be Giants.
I'm a Hypnotist, a thiologist, a lady.
I love they might they might they might might they might they might they might they might they might they might they might they might be gig. Oh my god, classic good band. Nerd music for nerds. It's so good.
Yeah.
Also, they wrote child the albums for children.
I'm like, why? You already did that.
Yeah, those are just children's and adults, yes.
Particle man, let's go.
Yeah.
So Carmichael is going to show the crowd what June did.
Right.
So he's like, I need a volunteer. And Gus is like, oh, you need a volunteer. And he's like, yep, I'm going to take you Gus.
And Gus is like, oh man.
And Jack is like, do is you're told Gus, which I was really pissed about.
Which is what Gus has been told all night.
Yeah.
Like Leo, the coaked up behind the scenes guys.
Just like, no, smile. Do your good smile, and he does, and he goes out, and he smiles big. Poor Gus.
Yeah.
He deserves better.
I guess.
I mean, I'm indifferent to Gus.
Really?
I thought Gus was very cute.
Yeah, I thought Gus was adorable.
You do love a, uh, well, no, he's not her suit, because when he's not her, the, uh, the suit, he's not a very, very, very ha ha ha ha ha ha ha ha ha ha ha ha ha ha ha ha ha..... to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to. to, to, I'm to, I'm to. I, I, I'm to, I'm to, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I, I, I, I, I, I, I, I. I. I. I. I, I. I. I. I, I. I. I. I. I, I. I. I. I, I. I, I. I. I. I. I. I. I, I. I. I. I. to. I. to. to. to. to. to. to. to. to. to. to to to to to to to to to to to to to to to to to to to to to to to. to. to. to. to. to. to be hairier on the trunk. It's true. I would think if you got the male pattern baldness, you're going to be a little harrier
in the trunk.
It's got to go somewhere, right?
Yeah, where's that air going?
It's like when you get sweat glands removed, you have to sweat from somewhere else.
He's got like super hairy cabs. pan. Little, yeah, little scrub brushes in the back. So he takes Gus and we see him do this,
I loved the hypnotism thing with the watch. I did too. Where like he's like keeps waving his hand in
front of the watch and it will change wildly what time it is and then it becomes the swirly-swerlies and
then he like pushes his hand in front of it and there's a flash and a bang noise? How do you do that?
I don't know.
And then Gus is like in.
Yeah.
And he's like, you know, you've been hypnotized this whole time.
And he's like, I don't know if I have.
And he's like, okay, when I stand my finger,
she'll be under his control. He is. We also. the. the. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. the. the. th. th. the. the. th. th. th. th. th. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he. And. And. And. And. And. And. And. And. And. And. And. And. And. And. And. And. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he. And he's. And he's. And he's. And he's like. And he's like. And he's like. And he's like. And he's like. And he's like. And he's like. And he's like. And he's like. And he's like, he's like. And he's like. And he's like. And he's like. And he phobia, a fear of worms, which somehow Carmichael knew.
Well, we find out how he knew it.
Well, how did he know?
Because when we get, so they go through this whole thing of like, of Gus pulling the worms
out of his neck and then out of his stomach and ripping his guts open and everyone's seeing
it.
Did you like this? I thought it was fantastic.
Yeah, me too. I was like, Fulch he is sp sp sp sp sp sp sp sp sp sp sp sp sping, Fulch he's th. He's th. He's th. th. th. th. th. th. th. th. th. th. th. thi. thi. th. th. th. th. th. th. th. th. th. thi. thi. th. th. th. th. th. th. th. th. th. th. th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. So, th. th. th. th. th. th. tha. tha. thi. thi. thi. thi. tha. thi. tha. thi. thi. thi. thi. tha. th grave. No he's not. He's spinning spitefully because he knows he could never do this.
Just literally putting maggots into an oscillating fan. Come on. We need to make an answer the maggot phone t-shirt. Oh, we do. We do.
So there he's like goes to this whole thing and everyone's freaked out and then He snaps his finger again and Gus is fine
And this whole time Lily is laughing just cackling. She's like what's wrong with Gus? Why is he being so silly? Yeah, yeah, so I want to talk about the worm dick that comes out of his eye I don't know but it's fantastic I
feel like I'm never going to interact with dune is that okay I don't know
it's not a Katie thing no no no okay I just want to be really clear that's
not for you okay thank you thank you many years of friendship no no you're good I saw the documentary about Yodorovsky's doom. It's very good.
I have never seen that documentary.
It's great.
It's good.
It's good.
But yes, a worm dick.
I assume that those are doom.
Yeah.
So yeah, the dick busts out of his eye and like pushes his eye and his skull out
and it's very graphic and fun. is so fallically awful. It's just horrifying.
So good.
Did you say hornifying?
Yes, I did.
Yes, I very much did.
So then Gus is fine.
And they go back to the stage.
He says Dreamer here awake and snaps, and none of it was real.
And so Jack is like, well, no, I need to rewind the tape and see what actually happened. And when they rewind the tapepe. the the the the the the the the the the the the the, th. the, th. th. th. th. th. th. th. th. th. th. th. th. th. they, they, they, thoer, they, they, thr. thee, thr. thr. th. th. th. th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. I, th. th. I, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe, toe. toe. toea, toea. toea. toea. toea. toea. toea. toea. toea, toea, toe.a, toe. to rewind the tape and see what actually happened.
And when they rewind the tape, they see that, not Chris, too, Carmichael had gotten the information that Jack was scared of worms out of him.
He's like, what are you afraid of and he's like, worms?
Oh, I don't remember him saying that. Okay. Yes. During the hypnotism part, he has started extracting information to freak out Gus. Okay, okay, okay. What you see in the in the rewound, like, video tape is not what actually happened when we all saw it.
No, we hear Carmichael giving him the instructions like now they're on your neck.
Yes, and now they're you can feel them wriggling around inside of you.
You're getting hot, you're getting itchy. Yes. And Gus says I've never been more embarrassed in my entire life. He deserves better.
It's true.
It's true.
Mrs. Gus is at home.
Yeah.
And then we see the ghost of Minnie, Madeline behind Jack.
Well, that's when they rewind it and do, they like Lily's like, why don't you rewind
it and see what I did.
And then a nat ta tape. He's super ss. that's that's that's that's that's that's that's that's that's that's that's that's that's that's th. th. th. th. that's th. th. th. th. th. that's liked. that's like, that's like, that's like, th. thi. thi. that's, thi, thi's, thi, thi, th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi. thi. He's super slow mows it. He does frame by frame.
Yeah. And I love this. I thought this was an excellent touch. Me too. We see the ghost of Madeline.
And right before we see the ghost of Madeline, there's like a zombie hand that touches his shoulder. And I was like, oh, that's fucking creepy. It was very good. Because when we see her she's like, th. looks very white, ethereal, kind of, yeah.
Yeah, yeah. But this is some gross shit. The zombie hand is like, ugh. Yeah. And this is when
the shit starts going off the fucking rails. Right. Lily starts crackling with electricity,
and then her whole goddamn head rips open.
Loved it. Gus is doing the whole power of Christ compels you thing and she turns his head all the
way around.
And earlier he said, hey, Carmichael, I just want to let you know that my wife likes my
head facing this direction.
That made me feel very sad when Gus died.
I think I felt more of a kinship with Gus than you did.
You're a real Gus. Gus. I Gus. I Gus. I Gus. I Gus. I Gus. I Gus. I Gus. I I thus. I thus. I thus. I thus. I thus. I thus. I thus. I thus. I th. I th. I thi. I thi. I thi. I thi. I thi. I thi. I thi. I thi. I thi. I thi thi. I thi. I th. I th. I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I feel I th. I th. I th. I th. I th. I th. I thi. I thi. I thi. I thi. I thi. I thi. I thi. I thi. I thi. t. t. t. ti. ti. ti. ti. ti. ti. ti. ti. ti. ti. ti. t. t. always saying that. I am. I'm the Gus to your Jack Delroy. You tell
me things and I go, that's right, Alan. I would make a great sidekick. Yeah. Yeah. Anyone
need a sidekick? Call me. Don't you dare take my sidekick away.
412. 417-025. Leave us a voicemail. You need a sidekick. I might get in on that.
You know people are going to take it up? No, they are not. They love that shit. They love
they don't. No, they don't. No, no, they don't love my ideas. So she, yeah, she turns his head all the
way around and then she pulls Dr. June up by her like necklace of evil warding. Right, because she starts doing
the like like incantation to make the demon go away. Yeah. And so she pulls up up
up, slits her fucking throat open with a necklace. Grot's her, yeah. Dope. Very dope.
Yeah. And then Carmichael tries to give the demon the check, which I left
very hard at. That is comedy. That is comedy. That's actually very good comedy. He drops it on his knees. He's like a Braxis. I've always worshipped you. I think you're the bees knees. That's exactly
what I would do too. I mean, I know your instinct is to run at the danger. And I've always felt that
my instinct is to hide, but maybe my instinct is actually to just negotiate. Listen, I will bowed. Listen, I will bow to you. I'll to to to to to to to to to to to to to to to to to to to to to to to to to to the the the the the the the the the to the to to the to toe. toe. toe. the the the the the thi. the the the their their their their the the be. the be. the bese. the be. the be. I woes. I would the be. I would the be. I would the be. I would the be. I would the be. the be. the be. the the the the the the the the the the the the the the the the the the theaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseeaseea. I will. I thea. I will. I th. I don't give a shit. This, you've proven to me that you're real. I'm on board.
At breakfast, where do you come down on grilled cheese?
Because I make a mean grilled cheese?
Oh, I'm great.
Here's what you go to do.
You don't put the butter on the bread.
You melt the butter in the pan.
You fry the sandwich. We'll have it on an apple, a little slice of apple. I'll do a white cheddar and apple. Okay, yeah, a little pear maybe, a little cheddar and pear?
Maybe.
I feel like it has to be a really firm pair.
Sure.
Because a mushy pear, it's just gonna all turn to wet.
You're a little time on there?
I'm not a big fan of time. What? No, I'm not. But yes. But, yes. the, yes. the, the, the, the, the, the, the, the, the, the, the, th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi. thi. thi. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. t. t-a. t-a. t-a. t-a. t-a. t-a. t-a. t-a. teea. te. te. te. te. te. te. t go. Yeah, for sure. I'm so glad I agree. Yeah. See, that's why, see, now, if you were a Braxis, you'd let me be your minion. I'm fine now. I'm even down with buttering both
sides of the bread so the butter heats up the cheese on the inside. Oh, I've never done that. Yeah. Yeah. I'll give that a try. I'll give that a try. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that that th. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. th. Yeah. th. Yeah. th. th. th. th. I th. I th. I th. I that. I that. I that. I that. I that. I that. I that. I that. I that. I that. I that. I that. I th. I th. I th. th.. How did I beat my lactose and tolerance again?
I don't know that I did. I throw up and poop a lot.
He tries to give the demon the check.
Which is hilarious and the demon's like, yeah, I'll take that check, lights it on fire and then lights him on fire? Yes. And then we see like a dark screen with a like light devil face, and then
we get the station difficulty sign.
Yes.
And then it cuts to Jack.
And it has gone from like the four or five ratio to full screen.
And the like, the video type has changed.
And Gus is wearing a different outfit.
Yes. So now Gus is like encouraging Jack to like, come on out, the the video type has changed. And Gus is wearing a different outfit. Yes.
So now Gus is like encouraging Jack to like,
come on out, come on out, Jack.
Here's Mr. Midnight, Jack Del Roy.
And immediately there's like an element of menace to what Gus is doing.
Yes, because Gus has not been menacing to this point.
Right. And now you're a little scared of Gus. And we see the audience and we can't any of their faces and they're like
weirdly spread apart. They're like really bifurcated in the crowd. But they're
still wearing the Halloween costumes because you can sort of see like a
witch hat when one woman turns to the side and the the devil and the the skull
face. Yeah, the skeleton yeah. And everyone is laughing which is just some absolute nightmare shit. Yeah, it's very creepy.
And then earlier we saw that there were different sketches from the show as they were bringing
us up to speed on what the show is.
Right.
So now we start sort of cycling through those.
But Jack is like, what the fuck is going on?
Right.
He's in like the the like zookeeper
lady, but now she has a dickworm. She got that big penis worm. She's like, touch
it, it's harmless and it's a little urethra has teeth or something in it.
Yeah. Yeah. Yeah. And then we cut to Minnie being the guest again, which we learned earlier was the highest rated episode ever of the love night outs.
Where she's like barely breathing and holding an oxygen mask and talking about how she loves Jack,
which felt a little self-serving to me. Sure. It did not feel sweet. How he was embarrassed to be around all the
naked people at like Godspell or whatever he was doing. He is alive, he is alive, he is alive.
And then we cut again to, what's that? He said, ah, fuck me.
I feel like that you know a song from Godspell.
I know probably all of the songs were God's but. I grew up stupid Catholic.
Are you a theater kid? No. My cousins were in that play though. My cousin Joe is the devil.
Of course. Yeah. Still is. Take that show.
He's never going to hear this. He certainly didn't watch this movie.
So now we get the station difficulty sign and it melts. Yes. And we see, then we cut back to the show and Gus has some older woman on stage and they're spinning the Wheel of Wonder, which is just
Carmichael's spinning eye thing.
Right.
And someone says to him, is that just another thing you've managed to forget?
Well, that's what Minnie says to him when he's, he's, she's talking about like the, seeing
the naked people and he's like, I don't know what's happening.
Oh, yeah, yeah. And she's like, oh, is that just another thing you managed to forget? And like, you know, who doesn't want their dead wife, like lambassing them for forgetting
things?
I cannot wait to nag-rob from the grave.
I'm just like, he's gonna leave a room and my like ghostly voice is just gonna be
like, do you work at the electric company?
Turn off the goddamn lights!
Oh, that's gonna be great for him.
So we get this like montage and then ends with him signing the contract with the guy that runs, um, the network that he's on. And that guy is like, part of like, the, like, illuminati that he's like, like, like, the, like, like, that, like, that. He's like, like, like, like, that. Like, that. Like, that. Like, that. Like, that. that. that. that. that. that, that, that. that, that. that, that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. th. th. th. th. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. that. the network that he's on and that guy is like part of like the
like Illuminati that he's like gotten in with. Yes we saw that scene earlier in
the movie and from off screen a member of the press I guess who was at this
press conference yell something like what did you have to sacrifice to get here?
and then in this scene when we see it again he says Jack Delroy's greatest sacrifices have to sacrifice to get here? And then in this scene, when we see it again, he says Jack Del Roy's greatest sacrifice is yet to come.
Yeah.
Yeah.
And then he gets picked up by two guys and plague Dr. masks
and I'm not sure why.
And then we get, uh, Deobo or whatever the guy,
the satianic guy is with the guy with the owl head and bunch of other people, and they start like they're in the woods, but it's like on a set of the woods of the redwood,
and they start like shrieking at him.
Yeah, this giant scary unmoving owl.
Yeah.
And the skeleton guy from earlier.
I don't know, I don't know.
They're all wooing. They're not even shrieking.
It's like like like like like like like! Make it like owl noises at him.
Oh yeah.
And then the back wall of the woods like opens up and hits his wife on her death bed.
First they make him drink something.
Oh yeah.
What is it?
Yeah, the satanic stuff.
All right.
Okay.
He always got to drink stuff.
Yeah.
So he goes in to see his wife and at this point it has gone back to the smaller aspect ratio.
Yes it has.
And she's on the set of the TV show basically.
Yeah in a bed, dying.
Yeah.
And she's like, I need you to do one last thing for me.
I need you to kill me basically.
She points, she just like looks at the sacrificial dagger which is on her nightstand. So he's like, of the the the the the the the the th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi thi's thi's like, thi's like, thus. thus. thoes. thus. thi's thus. thoes. thoes. thoes. thoes. thoes. thi. thi. thi. thi. th. th. th. th. th. th. th. th. th. th. th. th. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. Yeah. th. th. th. th. th. th. th. th. th. to. to. to. to. to. to. to. to. toe. to. toeeeeeeea. toea. toeeeea. toe. toe. the. the. th of course, of course. She says they told you you could have it all,
didn't they? Ex at mini stage left. Yikes. So what's he do? You stabs her? Yeah. Yeah. Yeah, if I'm sav in my partner, it's gonna be slow.
Okay, but if you're sapping me, make it super fast, because I don't want to have a chance to get away. Oh no, I didn't want this! Yeah.
He'll be like, oh, God, I just pierced the skin.
Whoops, seducing!
And we can put a cool little hoop in there.
But he has not stabbed Minnie to death.
He wakes up and he's stabbed Lily.
Yes. And everyone around him is dead.
Screaming. And he keeps saying, dream, here awake and then it cuts to black yeah and then the
bottom of the screen says end transmission and then it says so it is done so it
is done so when I watched this I felt like it was building and building and
building and then the end felt like a bit of a letdown to me all of these like
sequential scenes of him doing the show, but being confused.
I guess I wasn't sure what to make of that.
It felt like, almost like they didn't know how to end the movie.
Huh.
But now talking about it with you, I'm like,
oh yeah, that actually sounds like a good movie.
To me, it almost felt like he had entered his own hell of like,
of like just repeating the mistakes in his life.
I guess?
On some level.
But he like loved making that show.
He wanted that show to be everything, you know?
Sure.
Like, who's to say that the Caveman sketch was one of the worst days of, you know?
I don't know.
Who doesn't love a feminist caveman sketch?
I think it could be very funny if done well. Come see my new comedy act, feminist gape woman.
I club them.
It's called Club Gatie.
It's called Club Gatie.
No, don't club Gatie.
It's a one woman show.
I should do a one woman show.
Who doesn't love a one person show?
You want some variety?
You're not getting it.
No, I do voices, don't work, I do voices.
It's me and it's, yins can't talk to me like that.
And it's a, ah, it's a spice and a meat to ball.
I was making, uh, the, the, the, the stew that you made for us the other night when
we came over for dinner.
And it has Dietellini and I was singing, Dietelini, Ditelini, Ditelini, I feel like everyone spent that meal mocking my Italian.
A lot of doing this, which now I'm doing this sort of chef's hands gesture,
which I don't really do at home, but now Lucy has been turning at me, thanks to you.
I'm a giver of giver of ideas.
Sorry, Detolini is fucking fun to say. I think there was also some Detalini smell my weenie that got in there.
I miss that, but that's good. That's pretty good, yeah.
Katie. Alan. Ratings face. You go first. Uh, so as a movie, I'm going to give this an eight.
Okay. I thought it was really enjoyable. I've watched it twice now. Yeah.
For the AI art usage, don't do that.
Just hire a fucking artist.
I mean, especially if you've got all these other people
doing all this other stuff and they only use it
for a couple little bits,
like just paid someone to is that thing of like the spear point coming in,
you're gonna get these little things of,
we only use it for a little interstitial things,
and now we have Humphrey Bogart in our movie.
So like, he's so handsome.
But yeah, I thought it was great.
I thought like, I was stoked to see something that wasn't based on a comic book book or a pre pre pre or whatever, like it was just a fun movie.
Kudos to all the Australian actors.
I thought you did a fantastic American accent.
No.
Except for the now that happened.
But yeah, I really enjoyed it.
How about you?
I really enjoyed it, but I feel like the movie we just discussed was better than the
movie I watched.
That often happens to me. Yeah, right, th, I, I, I, I, I th, I th, I th, I th, th, th, th, th, th, th, th, the th th th th the movie I watched. That often happens to me. Yeah, right? I would absolutely
watch it again. I wish there'd been more to like figure out. I don't know. Sure. It
kind of lays it all out for you, which normally I'm mad that things don't lay it all out.
Yeah. I'm gonna give it a seven. Yeah, I enjoyed it. Would watch. Nice and short. Get in, get out. Yeah. Seven. Yeah, seven. Also, a quick suggestion, if you're on shutter already watching this movie,
this is for, if this sounds interesting to you, watch this.
There is a film on there called The Last Man and the First Men.
Okay.
But, and it's directed by Johann Johansen, who's my favorite Icelandic composer.
Yes. Who passed away a few years ago.
And the film finally got finished and it got released.
And it's this like science fictiony movie that he did
where he just shot brutalist architecture
from like the former Soviet block countries.
And then Tilda Swinton is reading this sci-fi stuff over top of it.
Okay.
Of like people, two billion years in the future being like, hey, the universe is about
to end, let me tell you what's happened up until now.
So they're talking to people two billion years in the past from them.
Okay.
And it's like, it might satisfy those things
for you. Plus it has a fantastic soundtrack by Johan Johansson, one of the last things
he could post before he passed away.
Did he do the Mandy score?
He did the Mandy score.
Yeah.
He did the score for a bunch of films like Sikario and that one Stephen Hawking movie that came out a few years ago. But he's just fantastic.
Like, I love his music so much.
I'm skeptical of Tildeswinton.
Why?
I mean because of Suspirey.
That Suspirea remake ruined me.
Man, the, the, the, the, the, like, difference of opinion that we had, the
difference of opinion that we had, listeners had on that movie is so fine. I know.
Speaking of which, Katie, can I read you a quick email that we got?
Sure, can I cough real quick?
This, the headline for this email is suggestions and a complaint.
Oh, dear Alan, I watch Enter the Dragon...
Excuse me.
I'm here too.
Just wait.
All right, well, I don't like to be left out. It's a real fear of mine. You want to be left out of this. Okay, great. Dear Alan, I watched Enter the Dragon yesterday.
How dare you?
So strongly agree with you, listener.
Also, dear Katie and Alan.
Hi, hi, it's me, Katie, your friend.
What's up?
I listen to your whole archive now and have noticed noticed that you've never covered some of my favorite oldies from my own country. Oh!
So if you're ever stuck for ideas or want to watch some older films, I have some suggestions.
Okay, what is your home country?
Uh, well, that's gonna be revealed right?
I'm sorry I'm just getting ahead.
Maybe I'll just shut my mouth and let you read.
No, no, I like this. This is why I'm not a good side kick. I'm always, I'm always, I'm always, I'm always, I'm always, I'm always, I'm always, I'm always, I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm th. I'm to. I'm to to to th. I'm to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to watch. I'm to to to to to to to to to to to to to to to to to the the the the the the the thi. the the thi. the the thi. the thi. thi. thi. to to to to to to to to to to to to to to to sit back. The Ealing horror, Dead of Night, 1945, which I may overrate
because I'm a film fan from Ealing in London. Okay, they're in Angland. Okay. However, the Michael Redgrave segment
is generally considered both excellent and influential. Okay. I have never heard of Dead of
night. I will check that moving out. 1945. 1945. He then suggests, or they then suggest two films that I would like to do in this podcast.
Okay.
The Dr. Fibbs films.
Oh, you have talked to me of these.
Yes. So there are two films in the US for Reasons.
Okay.
Which has a very sympathetic portrayal of a cannibalistic murderer and would be rapist.
It's not hard to watch the scene though, don't worry.
Okay, thank you.
As well as a lot of fun and daftness.
Ah, brought me back. You brought me right back in with that.
Don't be daft. It is one of very few films that
have ever made, ever left me with the creeps as well. Oh good. Quartermasts in the Pit, which
gave me nightmares when I was four but remains an absolute classic.
Don't don't show your four-year-old scary movies. It's not right for them. They don't know
the difference between real and fake. You can't do that. Go on. And then this is just a wild card. Parents from 1989 is an American film I would recommend.
And also can't help but notice you've never covered the first great horror film in history,
Nosferatu. What is there to say? I got no jokes for that? I got no jokes for that. Do you realize the pressure that puts on us on us the jokes on us to make to make to make to make to make to make to make to make the jokes to make to make to make the jokes about to make to make the jokes about to make to make to make the to make to make jokes about no jokes about no jokes about no jokes about no jokes about no jokes about to make jokes about no jokes about no jokes about no jokes about no jokes about no jokes. to make to make to to to to to to to to to to to to to to to. What. What. What. What. What. What. What. What. What. What. What. What. What. What. What. What. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. It. It. It. It. It. It. It. It. I. I'm. It. the. I. So, the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. the. that. I got no jokes for that. Do you realize the pressure that puts on us make jokes
about Nosferat to? Sir slash May I'm no. But I know you won't cover a silent film, chicken.
Yes, I'm fucking cowardly. If they're not talking, why am I? Why don't we just release an entire
episode of silence and say this is our Nosferattu episode? Next time one of us is sick, that's what we're doing. We'll send all title cards with it. I love that. Lots of love, Arlo of England.
Thank you Arlo of England. Lots of love to you too. Arlo, thank you so much lots of
love to you. I noticed that you did not say as you would like to hear our line of duty podcast. That's right. How do you feel about our foray into British crime?
How do you feel about us talking about the most fuckable man in England?
Martin Compton.
The Comstern. The Comster.
Oh man.
The Comster!
Unresistable. That's not the word.
What? I'd put it out there, could resist.
Oh yeah, I could go without fucking Martin Constan for the rest of my life. What are we doing next week, Alan?
Should we do another movie?
We should do another movie because I love doing this with you and I will do it until one
of us, one of us one of us one of us o'er than the other.
What movie should we do, assuming we're both alive next week at this time? Let's do a little punk rocker. We're we're we're we're, we're, we're, we're, we're, we're, we're, we're, we're, we, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're, we're both, we're, we're both, we're both, we're both, we're, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th, th. We. We. We. We're, th. We're, th. th. th. th. th. thi, to to to to to to to to to to to to to to to to to to to to tooo, to, to, to, tho, th. One of us older than the other. I'm a sort of old punk. No, I'm definitely an old punk. Uncle Peckerhead. I'm very excited for this. A lot of people have recommended
it to us. Yeah. We've been tired of looking up our own movies and have finally started looking
at the ones you people have recommended. So here we are. Congratulations. You finally get a voice. You know what, fuck you pay me. Let's do this. Just kidding. the th. th. th. th. th. the. th. th. the. th. the. the. the. the. th. the. th. the. the. the. th. the the the. th. th. th. th. th. the. th. the. the. the. the. the. the. the. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. I. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. the. th. let's do this. Just kidding.
Uncle Packerhead, it's on the streaming services.
We're going to talk about it.
Yeah. Come back for that.
Hit us up on Patreon if you want to be a patron.
Yeah. Or Patron as a word.
We're doing the fifth element over there this month for our Action Movie podcast.
It's going to be a little late, but that's how life goes. Why are you telling them this on the main cast? Why are you doing this? Why are you making us look bad?
Because I, no, I have to get them ready for what they're gonna do when they become patrons.
I see, the guilt that you feel.
Yeah, oh yeah.
It's gonna come out on the-shirts on T-Public.
Hopefully we'll have a Answer the Maggot phone t-shirt for you.
Oh, Justin, I know you have a real job.
I'll send him a tech, see what he could do.
Answer the Magitphone.
How many full t-shirts can we have, though?
Okay, great.
His estate is going to come for us one of these days using his likeness without permission. Like his family members give a shit about him.
And we're not on social media so hit us up at where if
a family ambulance at Gmail.
to com. You can leave us a voicemail if you need a sidekick or for any other reason
4124.007.005 and 5.005. to. if you want to send us anything in the mail.
Send me a written invitation to be your sidekick.
Yeah.
I would love that from you.
Send me a written invitation to be your sidepiece.
Yeah.
You got a partner.
You also want to to be your sidepiece.
That's how it goes.
You can't happy, but still I'd like to be included. I just to be the energy the energy the energy the energy the energy the energy to be the energy to be the energy to be to be the to be to be to be to be to be the to be to be to be to be to be to be to be to be to be to be to be to be to be the in a to be to be to be to be to be to be to be to be to be to be to be to be to be to be to be to be to be to be to be a to be a to be a to be a to be a to be a to be a to be a to be a the invitation. the in in a the in a the in a the in a the in a the in a the in a the ina.s.s.s.s.s.s.s.s.s.s.s.s.s.s.s.s.s.s.sitea.sitea.sitea.sitea.s.s.sitea.s.s.a.a. I. I. I. I. I. I. I to. I. I really don't have the energy to be anyone's sidebees.
I don't have the energy to take care of myself, let alone two people.
And Katie, Alan.
Can you take us out?
Thank you for listening to another episode of WhereWolf Ambulance.
Bye-bye.
Bye-bye.
And bye to you. And ings at the pool.
No way to in Finland's to fulfill reviews.
Killing the clouds and let the face.
Pinning the enemy in his face.
Appe inside of his case.
Please make a good in your grave.
E.T. END. A moral comedy reviews, hungry, Brian,
Oak Wayne's and Stephen King.
E.M.D.
We live deliciously, bad temperatries, Obes, Presley come to date.
A paranormal act in tis.
From Mr. Rogers to see.
E.D.
E.
E.D. From Mr. Rogers City, EFT, EFT!