The Daily Show: Ears Edition - Behind the Show: Jordan Klepper On The D-List Turnout for Trump’s Hush Money Trial

Episode Date: April 22, 2024

Recorded Thursday, April 18th. Jordan Klepper is joined by Supervising Producer, Ian Berger, and Segment Director, Zach Golden, to take us behind the scenes of Donald Trump’s Criminal hush money tri...al in New York. They discuss how they prepared for this shoot given Trump’s promise of ‘all hell [breaking] loose’ and how they pivoted when they found there was actually more media than MAGA supporters. Plus, Klepper and team talk about running into Andrew Giuliani and the one MAGA supporter who was not just proud of her January 6th attendance, but plugged her appearance on America’s Most Wanted. See omnystudio.com/listener for privacy information.

Transcript
Discussion (0)
Starting point is 00:00:00 Survivor 47 is here, which means we're bringing you a brand new season of the only official survivor podcast on fire. And this season we are joined by fan favorite and Survivor 46 runner-up, Charlie, Charlie, I'm excited to do this together. Thanks, Jeff. So excited to be here, and I can't wait to bring you inside the mind of a survivor player for season 47. Listen to On Fire the official Survivor podcast starting September 18th wherever you get your podcast. You're listening to Comedy Central. Hello and welcome to the Daily Show Ears edition. This is Ian Berger.
Starting point is 00:00:46 I'm a supervising producer at the Daily Show. Today I'm joined by Daily Show segment director Zach Golden. Zach, how are you? Hey, I'm good. Happy to be here. We're also joined by a Daily Show contributor, Jordan, how's it going? Hey, everybody, glad to be here. Earlier this week, we were downtown. It was interesting, as always. Jordan, this was another Trump trial day for you.
Starting point is 00:01:08 How did this day compare to previous segment? When we filmed on Monday, it felt like deja vu. We'd gone down to the earlier indictment hearing where Trump first appeared downtown. We didn't know what we were going to get. And frankly, we got more of the same. This was, uh, you know, this was, we joke, this was the delisters who came on out to support Donald Trump. And I fully will wear the hat of a delistor who came out to see what was going on that day. This, it seemed like it was a small crowd of, boy, numbers-wise, who people were really supportive of Donald Trump. I'm talking maybe in the 20s, low 20s.
Starting point is 00:01:49 You had hundreds of media there watching the spectacle around that, and you had the people who were drawn to whatever the scene was. There was some waves of anti-Trump protesters as well. But I think we saw a lot of familiar faces. We saw some people we expected to be there there there there there there we saw people who wanted attention and realized this was the place to go get it. I would like to point out, we even interviewed the same guy that we interviewed before and we kind of forgot about this because we, you do so many.
Starting point is 00:02:18 So sometimes I've, like, people seem familiar and then they're not, but we actually, a guy with the scarf is someone we actually interviewed previously down outside the courthouse. So I don't know if he exists outside of that park, if he has a life outside of that. But so far we're two for two with him. I think people, the ecosystem around the Maga universe is a fascinating one. And there's many podcasts that we've spoken on and can speak to about the ones that exist in rural America when we go out on the road but the ones that happen here in New York based around New York
Starting point is 00:02:53 events specifically based around the trial is super hyper-specific. You have a handful of Long Island folks who are Long Island Republicans who tend to wear shirts that talk about, what was it, not Long Island Strong, what is, what is their shirts? Oh, the silent majority, they were silent majority shirts. We talked to one guy who makes Maga hammocks. We've seen him multiple places including at CPAC. You had Laura Lumer, who is a far right maga celebrity. Maybe that's too strong a term, but she's a personality in the far right. She saw an opportunity.
Starting point is 00:03:29 Last time we were here, George Santos saw an opportunity, Marjorie Taylor Green saw an opportunity to show up, get all the cameras on them, and make a big show of it for Donald Trump. This time, they didn't have the time or the frequent flyer miles to get here. So Laura Lumer decided to come on in, get the pictures taken, get the cameras pointed at her, and get a retweet by Donald Trump. So I think that was a big win for her. But you start to see this. You're like, okay, here are the people
Starting point is 00:03:52 who see this as an opportunity, less as an opportunity to show fealty to Donald Trump and or 10,000 more Twitter or X subscribers. Yeah, exactly. Zach, so before the day, Trump had sent a message out about all hell breaking loose. Trump said all hell is going to break loose. Are you going to go ape shit today? Are you ready to go ape shit today? I want to see how it plays out.
Starting point is 00:04:23 But you're going to see how it plays out but you're gonna slow walk the ape shit. Right, slow walk it. Trump supporters are calm peaceful protesters. Yes. They would never rush into a federal building and try to disrupt proceedings. Donald Trump would never advocate for that. I would say that January 6th thing. Can you tell the audience a little bit how we prepared for that and what you expected to see off of that message? Yeah so you know th th. th. th. th. th. th. the th. th. th. th. th. th. th. th. to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to the the the the the the their their their their their their their their th. th. th. th. the. the. tod. today. try. try. try. try. try. try. try. try. today. today. today. to today. to to see off of that message? Yeah, so, you know, I think that was sent out in a fundraising email, like three or four days before the trial was set to take place. And for us, it was an immediate sort of like, you can get so used to Trump's dangerous rhetoric that you can sort of become numb to it, but when it is coalescing around like specific events, you do need to take that more seriously.
Starting point is 00:05:07 So we wanted to approach this like it was going to be hellbreaking loose and see if that was a reality or not a reality on the ground. So yeah, we prepped a whole bunch of jokes, we have prepped a whole bunch of questions, sort of, and you can see some of them in the piece, like, you know, where your pitchforks, etc. And then when we got there, it wasn't? It just wasn't? I mean, you know, and the thing that I think is most striking is like, not only was it not, but the people that were there would never, they would never do anything like that. Except for the amount of people we met who were at January 6th. I think we even cut someone out. This guy had a little Santa vibe going.
Starting point is 00:05:51 Jordan was like, were you at January 6th? And then he thought and thought and didn't have an answer. And then he was like, I think I was home watching TV. Yeah, like, I'm not a airtight alibi. You can't admit it it it th th th th, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, like, I thi, I thi, I thi, I thi, I'm thi, I'm th, I'm thi, I thi, I'm thigh, I'm thigh, I th, I th, I th, I th, I th. th. th. th. th. thi, I th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. th. thi, I, I, I, I, I th. thi, thi, thi, thin, th. th. th. th. the. the. the. the. the. the. the. thi., like they're not coming after you from from a piece on our show, like you're not going to get indicted. I'll be, I don't know, man. These people have caught a lot of weird ways. I think maybe they're learning their lesson. I mean it is remarkable still the disconnect between Donald Trump and his rhetoric around January 6th, and again,
Starting point is 00:06:22 Donald Trump has always played in hyperbole. And a Donald Trump speech is full of every point of view known to man, which I think is a defense mechanism. He will ask you to be there. It will be wild. He will get up there on January 6th and talking about fighting like hell. He will also spew stuff about peace. He will also degrade people.
Starting point is 00:06:40 He will say all the things you could possibly say. Therefore, giving him, essentially, if not a free pass, something for his folks to point to, to be like, he was talking about a peaceful speech. It was like Donald Trump was trying to incite a mob. And he said all of these different words, you're pointing to the words that said peace, but the actions of the day and the tone of the day pointed too, to to to to to to to to to to to to to to to to to to to to to to to to to to to the to the the the to the the the the the the the the the the the the the day, too, the the the the the the to the, the, the, the, the, the, the, the, the, the, their, their, their, their, their, their, their, their, their, their, their, their, their, the the the the the th, the th, th, th.... the the the th th th th the, the, the, the. thean, they. thean, they.ean, they. they. the thean, they. the thean, the the the thean, day pointed towards mob mentality. And yet when we go to a place like we were at Monday, people are not only divorcing themselves from the reality of what happened on January 6th, but also of like the culpability of Donald Trump and his words. And so yet again we're in the same conversation of be there, be wild and hell breaking loose.
Starting point is 00:07:21 Is he just fementing anger and violence? And frankly, what should be clarified is, they didn't show up. If that was a call to the Maga Faithful to come out and hell is breaking loose because you're so upset, like, that might be happening on internet, but in the real world, this is just a bunch of people trying to fight for Donald Trump. Their fight is not your fight, at least the the the the their their their trying to get airtime. It's not a bunch of people trying to fight for Donald Trump Their fight is not your fight at least in lower Manhattan. Certainly not lower Manhattan. No, certainly not there
Starting point is 00:07:49 But you never know because he's got a bunch of days He's kind of doing a residency at that courthouse, so you know, maybe maybe they're showing up in week two or three It's a good work material. I get working material. to that's material material material material material material material material material material material material. the the the the the material material material. that's they? they? Let's they? Let's they? they? they? they? they? they? they? they? the the they? they. they. they. they. they. they. they. they. they. they. they. their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their their tha. tha. tha. tha. tha. tha. tha. te. te. te. tea. tea. tea. tea. tea. thathe songs are cleaner in Christmas. Is he bringing some special guests to get the ticket sales up later on? I think I mean Stormy will be there there will be special guests Michael Cohen. Yeah it's interesting they haven't been showing up to the New York events but in terms of like how that represents his support a few days ago we were just in Pennsylvania and it was like as fired up and crowded as ever and that was in rural Pennsylvania. I wonder if some of his crowd think like the lies about New York being a hellhole kind of
Starting point is 00:08:37 impact their you know the number showing up here. They're like I can't go to New York I'll get mugged. I think there was a joke that we cut that was like, if all hell is breaking loose in New York City, how do you even know because it's already like full of carnage, right? Like how would you even tell the difference? Well the irony, too, you know, the narrative is that he can narrative, stick with it. Donald Trump, after the trial, went to Harlem and they reposted nothing but videos from their perspective of him being beloved. People cheering. They love Trump here. The narrative is wrong. He is, he has adored when he goes out in New York. I think, again, take the clip you want, make the narrative, but if you're going to push the narrative that he taken a fair trial because nobody likes him in New York, and yet you then go to a place in New York and are
Starting point is 00:09:27 bragging about how much people like you. It's like, this is, pick a lane you guys. Among the many great characters we talked to, there was also a woman who had the most smokers voice maybe in human history. She told her she made thia the to to to to to told told told told told told told told told told their told told told their, told told their, told told told told told, told, told, their, their, their, told, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their. And, their. And, their. And, tho. We. Wea. I. I was. I was. Wea. Wea. Wea. Wea. I was. Wea. Wea. I was. Wea. I'm. I'm th. I'm tho. I'm thiiii. I'm talking about Zach. She told her she made an appearance on another television show. America's Most Blounted. Mm-hmm. She also had to, wouldn't grant us the interview until she finished her, finished smoking her cigarette on the park bench, which is just, you know, listen, I'm glad that she
Starting point is 00:09:58 took the time she needed to mentally prepare to go off. Is tod- the January the January the January the January th-I th-I th-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-I-s-Inia-s-s-s-s-shaea-shaea-s-s-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-a-s? is is is is is, she was was was was was was was to get to get to get to get to get to get to get to get to mentally prepare to go off. Is today the January 6th of April 15th? No. What January? I was there January 6th. I was there. Where were you inside the rotunda? Are you in the office?
Starting point is 00:10:14 Were you holding a podium? Where were you? It was breached before we even got there. Is that why you're here early today just to make that first first, that first, th w wa, tha, that, to make, that, that, that, to make, that, that, to make, that, to thi, to to to to to to to to to to to to to to to to to the to the, to to to to to to, to, to, to, to, to, the, to, to, to, to, to, to, to, to, to, to, to, to, to, the, the, the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the thi..e. thi. the. thea, thi. thean, thean, thi.a. thi. thi. thi. thi. thi. thi. toooooooo. thea just to make sure you get that first wave? Well, I have done pretty. Go back and watch America's Most Wanted. I made a grand appearance there when somebody said we got what we deserve. God bless, I'll set my tea up. She had that sassy grandma vibe, or like, or like our sassy, sassy aunt who's got some stories, who like you give a couple genittonics to her and hang out at the end of a party and let her go. Like she had, and also one of those who you interview and you're like, wow, she had a lot of opinions
Starting point is 00:10:50 and she just wanted to chat and then you get back into the edit after you've relaxed and exhaled and you watch her interview and fall in love with her all over. Yeah, I mean, truly we used her a bunched, to to to to to to to to to to to to to to to to to to to to to to their, to to to their, their, th, th, thi, thi, thi, thi, thi, thi, thi, their, their, who tho, who their, who their, who you're, who you're, who you're, who you're, who you, who you, who you, who you, who you, who you, who you, who you, who you, who you, who you, who you, who you, who you, who you, who you, who their, who their, who their, who their, who their, who their, who their, who their, who their, and their, and their, their, thi, thi, tho, tho, tho. And, tho. And, th. And, th. And, th. And, th. And, and tho. And, and tho. And, and tho, and th. And, we used her a bunch of the piece. In our first cut, we had twice as much stuff. And it was all funny and entertaining, but at some point you're like, we can't just lean too heavily into one person, but there was an edit, like an early cut of this piece that had even more of her gold. Yeah, she was truly remarkable. And that's the kind of person that't hope for at every Thanksgiving. You know, it's like that's the person. I feel like she went and she finished her cigarette
Starting point is 00:11:30 because she was merely like warming up her instrument before she came out to do the interview, which is her like New Yorker smokers voice. I think if Trump was watching, I think we got a communications director right here and there. She is the kind of person who I want. Much like the menthol filter she had in her cigarette, I would like her to filter the news of the White House and deliver it to us on a daily basis
Starting point is 00:11:54 if he gets that job once again. If she was, I feel like she could run for city council somewhere and it could work. Oh for sure. And something, she also, I don't think th th th th th th th th th th th th th th th th th thi thi thi thi thi thi thi thi thi thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, the the the the the the the the the the the the the the the the the the the the the the, the the, the, the, the, the, the, they, th. I th. I th. I th. I thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi, thi. I thi. I thi. I'm, I'm, I think, I thi. I'm, I thi. I thi. I thi. I thi. I thi, thi, thi. Oh for sure. And something she also, I don't think this made the piece either, but she said that on January 6 she was sitting outside like somebody brought a chair for her and she was just like sitting outside and watching you know, she was in the smoking section of the interruption. And I just picturing her just like sitting outside chain smoke and cigarettes being like, yeah this is what America this is what America is for. You guys take it easy we know your lungs aren't going to
Starting point is 00:12:29 catch you up this hill. In the conversations we have with people on January 6th they no longer make our pieces anymore because the narrative has been told over and over again but the counter narrative of how peaceful and meditative January 6 was to the people who are talking about the violence of January 6. Like we are a few years away from it in far right circles being seen as almost like a Zen resort that you can go to the way people talk about like, oh I was sitting in chair. We were watching it. It was a beautiful day like it gets the hyperbolic. It'll be it'll be it'll be the vernacular like what was it like were they fired up. No. No. It was. It was. It was a. It was a. It was a. It was a. It was a. It was a. It was a. It was a. It was a. It was a. It was a. It was a the. It was a the. It was a the. It was a the. It was a the. It was a the the the the the the the the the the the the the the the the the the the the the the the the the the the the the. It was. It was. It was. It was a the. It was. It was. It was. It was. It was. It was. It was. It was. It was. It was a. It was a. It was. It was a. It was. It was. It was. It was a. It was. It was a. It was. It was a. It was a the. It was a the. It was a the. It was a the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the through the roof right now. It'll be, it'll be, it'll be the vernacular. Like, what was it like?
Starting point is 00:13:06 Were they fired up? Not now, it was all January 6 vibes, man. Couldn't get the crowd going. Super chill, yeah. What? Yeah. Yeah, she's wonderful. All right, hold that thoub.
Starting point is 00:13:15 that. the news and thought to yourself, wow, the Supreme Court sure does suck. We made a podcast about that. We sure did. There is a supermajority of conservative maniacs on the Supreme Court right now, really doing some damage. I'm Michael. I'm Riannan. And I'm Peter. Our podcast, 5-4 is about all of this. Every week we dissect and analyze a different ruling that has made our country a little worse, a little more cruel. And you would not believe how many of them there are. Check out five to four. That's the number five, dash the number four, wherever you listen to podcast. Last court appearance we had some stars that you mentioned like George Santos, Marjorie Taylor Green. This time, there was Andrew Giuliani's son who recently ran for Governor of New York.
Starting point is 00:14:11 While there was more press than there were MAGA supporters, I did run into one January 6th B List star, Rudy Giuliani's son. I was in Washington D.C. on January 6th, I was with President Trump. I remember him talking about peacefully protesting. Some people were talking about peaceful protests. Some people also on January 6th, we're talking about trial by combat. Let's have trial by combat. Do you know anybody who was talking about that?
Starting point is 00:14:34 Oh, you know, look, I would say the going on inside the courtroom or no? What was that like, Jordan, talking to Andrew? Oh, exciting. Yeah. It's so exciting. You know, this is why you do it. You know, you get a chance to rub elbows with the Hoy Poloy and Andrew Giuliani. I mean, again, we were, we saw he was going around trying to talk to media, trying to align himself with Donald Trump, supporting Donald Trump, and so it was an opportunity for us to discuss with him, one his allegiance and whether or not he was on board with this narrative of this being a peaceful event, which to be fair, it was a fairly peaceful event, but it being the rhetoric leading to potentially
Starting point is 00:15:25 a dangerous event and comparing that to what happened on January 6th, and specifically comparing that to what his father said on January 6th. Which he weirdly forgot. I think he seemed to have forgotten. It's shocking because it seemed pretty public and it was in the news, so I don't know, maybe if somebody give him a link or something. I mean, who hasn't memory hold their father inciting a riot, right? It's fair. Here's a picture of your dad at Four Seasons Landscaping.
Starting point is 00:15:53 Do you remember this guy? This is another picture of him with his hair dye bleeding down his temples. Is this the guy you're forgetting? Zach, how do you think Andrew felt about the interview when it was wrapping up? So the end of the interview, which didn't air, was definitely the most bizarre part because he was just getting, like, all of his machismo bullshit energy was coming out when he realized that Jordan had got him with the trial by combat thing. And it was just so, like, just so bizarre, just like devolving into these weird, like, power dynamic of, okay, yeah, you're very funny, very, you know, just exactly what you would expect, like him just completely losing it.
Starting point is 00:16:38 And it ended in this very weird handshake that lasted a really long time, right Jordan? That seemed to last like way too long. It was one of those bro handshakes of like, you know what I'm doing with this handshake, bro, right bro? Yeah, a lot of bro. He's like a lot of bro. Even if it wasn't verbalized, it was, I felt a bro handshake in there and I'm very uncomfortable in those situations. Do you feel my my my my my my college college college college college college college tho. Do tho. Do tho. Do tho. Do th. Do th. Do you th. Do you th. Do you th. Do you th. Do you th. I th. I th. I th. I th. I'm tho. I'm tho. I'm tho. I'm tho. I'm th. I'm th. I'm, I'm, I'm, bro, bro, bro, bro, bro, bro, bro, bro, I was, I was, I was, I was, I was, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm, I'm th. I'm th. I'm th. I'm th. I'm thi. I'm thi. thi. thi. thi. the. tho, I'm, I'm, I'm, I'm, I'm, t. to, th. th. tho. tho. tho. tho. the. Do you feel my college golf strength coming through? That's right, college golf, baby.
Starting point is 00:17:07 That's what I did. I was an athlete, college golf. It's just so interesting that he would even, you know, I always find it so interesting that the people, they have the hubris to think that like, you know, yeah, I'm gonna talk to this guy who's like very well. well known for her for pointing out hypocrisy in public figures like me but like no that would you know that's that would never I'm ready it's like he went into the interview without having any idea what we're gonna talking
Starting point is 00:17:31 but he's like let's go let's do it it's it's all peacocking that the entire event is just peacocking everyone who shows up Julianne is there he's trying to try and to try to to try. I I I I I I I I I I I I I I I I I I I I to to to to to to to to to to to to to to to to to the to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to toe-I I'm toe-I-I-I-I-I-I-I-I-I-I-I-I I was to to to to to to to to to to to to to to to to to the the the the the the the the the the the the the they. the they. they. they. they. th ththee. the. the. thean. thean. thean. thean. thean. theeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeto show up to Donald Trump. Laura Lumer is trying to do that even the wild wild guy with a huge flag He is there peacocking. Nobody wants to talk about anything Very few people are there just because they have What feels like an earnest gripe it feels like an earnest opportunity for so many people and that's what we found with? Julianne. Yeah, no, that I mean, it's interesting. It's interesting that he showed up because he haven't heard from him in a while, but I guess if you're that figure in New York, this is your opportunity. I don't think he'll be showing up again for a while, but here was his shot. There was a there was a guy emblematic of it all. This is not a ton of people there.
Starting point is 00:18:19 But I remember as we were leaving, a guy came in with his trump paraphernalia and he was meeting his buddy. They had a big hug at the entrance and overheard him saying, okay, let's go out, let's go get in there. I see a lot of cameras. Let's go talk to the people, talk to the cameras. And I was like, oh, yeah, to be the mouthpiece of a movement they believe in. Okay, but I think a lot of people are just there like here's where the cameras are.
Starting point is 00:18:50 I have the hat on, I have the show, let's let's dance. It's interesting because I read something that was talking about day two about how there was really only one supporter there, which is very funny and sad. It's hard to make TV out of things not happening So we don't automatically go and do that But I would be very curious to talk to that one supporter and be like what's it like? What are your plans for the day? What do you have in store for day three? But thinking about that how do you see? I guess like do you see a crowd coming back to this trial? I wonder if it's like? thuuuuuuuu? Do th. Do th. Do th. Do th. Do thi thi, like, like, do thi, do thi, do thi, do thi, do thi, do thi, do thi, like, like, like, like, like, like, like, like, like, like, like, like, do thi, do you thi, like, like, do you thi, do you thi, do you thi, like, like, like, like, like, like, like, like, do you thi, do you th, do th, do th, do th, do th, do th, do th, do th, do th, do th, do th, do th, do th, do th. thi, do thi, do thi, do thi, do thi, thi, thi, thi, thi, thi. thi. to to that's to to that to to to that to that that to to the. to the. to the. to the. thi. the. trial. I wonder if it's like later on if things are looking bad, Jordan, what do you think's going to happen? I don't think Trump is going to get a big response here in New York City and I think he will bring, he will articulate that as this being a biased liberal town, but I also think at its core, it's bullshit this, I'm doing this for you, I'm fighting for you as a way to get people people people people people people people people people people people people people people people to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to to... to to to to to to to to to to to to to their. their. their. their. their. the. the. the. thr. thr. thr. thr. thr. thr. thr. thr. the. thr. thr. thr. thr. thr. thea. thea doing this for you. I'm fighting for you as a way to get a rise,
Starting point is 00:19:45 a way to get people to cheer at a rally. But deep down, he's not doing it for you. This case, the farther way we get, this case is about him having sex with Stormy Daniels, him then, uh, during an election, months before, like what, a month before the election, paying for Storm Daniels not to talk about the sex that they had. Now, that's Trump's thing. And ain't the rest of America's things. And him trying to connect that to your struggles, people who have to work, nine to five, people
Starting point is 00:20:15 would have to take time off of work, they would have to figure out what to come on down and support and yell on your behalf? Like, no, the people who are doing that are people who see it as a job opportunity, not people who see it as a righteous quest. And so I think there's a faulty premise in Donald Trump trying to play a heroic victim for the rest of America. And I think you see that in the numbers of the people who are attended. Yeah, it doesn't seem like his logic. Like it'll track with the most fervent supporters,
Starting point is 00:20:45 but you know, for your average, not as engaged civilian in America, like that logic just doesn't track if you know anything about the trials whatsoever. Also, these are, these are shows. We go to these rallies, and a lot of people go to the rallies because they're fun. They wait in line for 12 hours because they want to get inside.
Starting point is 00:21:07 They want to hang out with their pals and they want to cheer for Donald Trump when he comes on out. You don't get to see Donald Trump when you come to downtown New York. It's a legal proceeding that's happened inside a building that you're going to have no access to. If you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you you their th th th their their th th th their th th th th their th. th their th. th. thi thi the. tho tho tho tho to to tho. to to to to to to to to to to to to th. th. th. th th. th th th th th th th th th th th th th th. th th th th. th. to to th. th. th. th. to thi thi thi thi thi thi thi the the the the the the the the the the the the the the to to to to to to to to to the him on and you want the fricking show, it's almost like showing up and being like, well, no, you can't get into the arena, but they're broadcasting elements of the big game next door in a separate arena. And yeah, maybe some people want to be on the periphery there, but mostly the folks there are to tailgate and party, they want a ticket to the show, and their, their, their, their, their, their, their, the.... And, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, their, but, but, but, their, but, but, but, their, their, their, their, their, their, their, but......... So. So. So. So. So. So, their, their, their, their, is. So. So. So. So, is. We. So, is. We. We're, is. their, is. their, is. their, their. their. their. their. their. their. their. their. their. their. their. their. their. their. their. stadium and watching the game on the big screen that's being played somewhere else is never a good look in my opinion. That just seems a little desperate. But that's not even that it's like going to a stadium and them being like we're going to stream this event to your phones. Right. And you're not even going to watch it as a community. You're going to watch it to watch it the thap. tho. th. th. th. th. th. th. th. It is is is is is is is th. th. the th. th. th. th. the th. th. th. th. th. thi. the. the. tho. tho. the. thi. the the the the the the the tho. tho. tho. tho. tho. the th. the the the the the the the the the the the the the th. the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the. the. the. the. the. the. the. the. the. the. toooooooooooooooooooooooooo. the. the. the. the. together. Yeah, we haven't been to one of these in another state. I'm very curious about what it will be like in Georgia
Starting point is 00:22:09 In Florida when those things are happening. I'm very curious. I am very curious to see if it's if it's a similar situation If we go down to Atlanta and if people are are absent or if they they find this as a crusade that they want to travel for well the good news is we're gonna to have to have to have to have to have the to the to the to the the th, the to the the to the the th, the the the the th. th. the to the the to the to to the to to the the to to the the thi the to to to to to to to to to their their their their their their their their their their their their their their their their their their their their their their their the the the the the the the the the the the the the the the the the the the the the the the the the the. the thea. thea. thea. thea. thea. thea. thea. thea. thea. thea. the the the theaade that they want to travel for. Well, the good news is we're going to have so many opportunities, guys. This is the good news, and don't let it sink in, don't think too much about it, because you'll get depressed. But the good news is we have a lot of opportunity to make this kind of TV. Thank you President Trump for allegedly committing so many crimes. You've given us a lot of material and like a very busy calendar. So I mean, think about our lives, or maybe we're the victims here. You know what, this is, yeah, I think we've come to. I think, I think that's a victim narrative people can rally around Ian.
Starting point is 00:22:56 Thank you. Jordan you should tell the audience you're doing this for them, the way Trump does. You know, I'm a self-centered comedian and even I know that's a bridge too far. Well I'm doing it for them and travel points, so that's also for me. That's where I do feel like, you know who really hurts on this is you and the lack of travel points you're getting. I think what really is suffering is the buffet bar at the Delta Priority Lounge. Oh, great, the Delta Priority Lounge. Like, oh great, the Manat and Courthouse, I've done jury duty here, fantastic. I went to high school five blocks from here.
Starting point is 00:23:29 This is not exciting to me. Okay, we gotta do better, Trump. Get arrested in more interesting places. Thank you. I know, I love it, yeah, come on, get arrested in Charleston or a Hawaii arrest. I don't just something, something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something something. I to just something. I the the the the the the the the the the the the the the the the the the the the the the the the the the the the their. th. th. th. th. th. I is th. I is th. I is th. I is th. I th. I th. I th. the the th. the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the the th. I the th something to really, really give us something to the airport. Vegas, baby. I feel like Vegas would be very hard for him to get arrested. They'd be like, yeah, that's what we do.
Starting point is 00:23:52 This is all legal here. It's for most of it. We have advertisements for this in the airport, dude. Well, again, great job guys. It was a lot of fun working with to to to to to to to to to to to to the to the to to the to to their to their to thi thi thi. We thi. We to do thi. We to do to do to to to to to to to thiague thi. thiagui. thiage thiaguaguaguaguaguaguage thage thage thage. Vegas. Vegas, thage. V. Vegas, thage. Vegas, thage. Vegas, thage, thage, thage, thage, thage, thage, thage, thage, thage, thi. V. V. V. V. V. V. V. V. thi. V. thi. thi. thi. Vegas, thi. the. Vegas, toe. Vegas, toe. Vegas, toe. Vegas, toe. Vegas, toe. Vegas, toe. Vegas, toe. Vegas, thea. Vegas, thea. Vegas, tha job guys, great peace. It was a lot of fun working with you all. I'm sure we'll get to do it again. Jack, you're excited to get back out there. Same here, yeah.
Starting point is 00:24:12 All right. Pumped and ready to go. Let's go to Georgia. You know, and before we go, actually, I want to give a shout out to our podcast producer Ashley Williams she is leaving us for the today's show very sad God bless moving from the daily show to the today's show a little bit more present I can respect it I understand it actually thanks to theinnecler's Ashley thank you for all your hard work and having to listen to the conversations of a bunch of blowhards like us and so we
Starting point is 00:24:40 appreciate it and we wish you well on your next endeavor. Jordan, Zach, thank you and thank you for listening to the Daily Show the Daily Show podcast universe by searching the Daily Show wherever you get your podcasts. Watch the Daily Show weeknights at 11, 10 Central on Comedy Central and stream full episodes anytime on Fairmount Plus. This has been a Comedy Central podcast. Hey Jen, yeah. When did you guys start hiring competent people? Because that, the, the, Ashley, who was running the podcast, has, I guess what you would call her shit together? And like, laid this thing out.
Starting point is 00:25:25 You know, you guys have really changed the culture from when I was there. Survivor 47 is here, which means we're bringing you a brand new season of the only official Survivor podcast on fire, and this season we are joined by Fanfavor and Survivor 46 runner-up, Charlie, I'm excited to do this together. Thanks, Jeff. So excited to be here, and I can't wait to bring you inside the mind of a survivor player for season 47. Listen to On Fire, the official Survivor podcast starting September 18th, wherever you get your podcast.

There aren't comments yet for this episode. Click on any sentence in the transcript to leave a comment.